![]() |
The AFU and Urban Legend Archive AFU People Vicki Robinson but im not in anyones sig list
|
![]() |
Vicki "But I'm not in anyone's .sig." Robinson
--
Jason R. Heimbaugh - jrh@uiuc.edu
"But I'm not in anyone's .sig." --Vicki Robinson
--
"But I'm not in anyone's .sig." -- Vicki Robinson
--
Michael D. Hensley | It isn't charity if you use someone else's money.
mhensley@netcom.com | The ends do NOT justify the means.
--
Stuart Derby | "But I'm not quoted in anyone's .sig."
sderby@bcm.tmc.edu | -- Vicki Robinson
|
From: catstyle@gofish.aiss.uiuc.edu (Jason R. Heimbaugh)
Newsgroups: alt.folklore.urban
Subject: The Official AFU "But I'm not in anyone's .sig" Fan Club
Date: 24 Nov 1993 15:11:19 GMT
Be a part from the start.
Join early join often.
We're now over the two fifty mark in membership:
Jason Heimbaugh, Founder
Michael Hensley
Stuart Derby, Receiver of the first stern rebuking for not getting the
quote right
and an honorary membership is being extended to Vicki Robinson.
Weeks ago, I wrote:
>--
>Jason R. Heimbaugh - jrh@uiuc.edu
>"But I'm not in anyone's .sig." --Vicki Robinson
Alan "joining the fan club (see below)" Rosenthal
--
"But I'm not in anyone's .sig." -- Vicki Robinson
--
Paul Tomblin - AFU's official "Snide Canadian"
Formerly pt@geovision.gvc.com - soon to be ptomblin@gandalf.ca
The "signature virus" of late 1993:
"But I'm not in anybody's sig" - Vicki Robinson
--
Derek Tearne. -- derek@nezsdc.icl.co.nz -- Fujitsu New Zealand --
______ This is a Usenet Condom<tm>. Roll the condom over the .signature
______} file before posting to protect yourself from .signature retro-virii
CAUTION: Effect on the Vicki Robinson .sig virus is unclear
--
Stuart Derby | "But I'm not in anyone's .sig."
sderby@bcm.tmc.edu | -- Vicki Robinson
|
Subject: Nothing to say
I *really* have nothing to say, except . . .
My .sig does NOT contain a quote from Vikki Robinson,
Odd Professor.
--
Robert Allison
--
Jean-Marc "Will not get rigor mortis for food." Rocher
rocher@husc8.harvard.edu
I was told we wouldn't have to include Vikki (Vicki?) Robinson in our .sig's
in this newsgroup.
Robert "still no Vikki quote here" Allison
--
Robert Allison
--
Michael D. Hensley | "But I'm not in anyone's .sig." mhensley@netcom.com | -- Vicki Robinson, in AFU
70700.763@compuserve.com |
--
Derek Tearne. -- derek@nezsdc.icl.co.nz -- Fujitsu New Zealand --
______ This is a Usenet Condom<tm>. Roll the condom over the .signature
______} file before posting to protect yourself from .signature retro-virii
CAUTION: This doesn't stop Vicki Robinson getting into your .sig
--
ted frank | "But I'm not in anyone's .sig" thf2@kimbark.uchicago.edu | -- Vicki Robinson the u of c law school |--------------------------------------------------- kibo number of 0.5 | Standard disclaimers apply
--
Tim "If I spell it 'Mottoe' can I be a Republican?" Dowd
(Sorry, Vicki, no .sig)
From: jaskew@maths.adelaide.edu.au (Joseph Askew)
Subject: Re: Few words for "cheese" in Chinese
In article <1993Nov28.021602.13689@nezsdc.icl.co.nz> derek@nezsdc.icl.co.nz (Derek Tearne) writes:
>Derek Tearne. -- derek@nezsdc.icl.co.nz -- Fujitsu New Zealand --
>______ This is a Usenet Condom<tm>. Roll the condom over the .signature
>______} file before posting to protect yourself from .signature retro-virii
> CAUTION: This doesn't stop Vicki Robinson getting into your .sig
I hear the herpes virus can pass through a condom too. Given virii
are not alive is Vicki Robinson dead by analogy?
Joseph 'Generally Intollerant' Askew
From: vjrnts@ritvax.isc.rit.edu (Vicki Robinson)
Subject: Re: Few words for "cheese" in Chinese
In article <2dbo2e$f2m@spam.maths.adelaide.edu.au>, jaskew@maths.adelaide.edu.au (Joseph Askew) writes:
>I hear the herpes virus can pass through a condom too. Given virii
>are not alive is Vicki Robinson dead by analogy?
>Joseph 'Generally Intollerant' Askew
Um, this thread is beginning to take a peculiar turn, here. I have been
assured by the Keeper of the AFU Undead that I am indeed un-undead, and have
been for some time. However, I am lately much more careful not to flash my
headlights or *anything*, because lurkers are everywhere.
Vicki "Would rather die by chocolate than analogy." Robinson
Helge "Just telling it, like, it is, like..." Moulding
(Just another guy with Vikki Robinson in my .sig)
Vicki Robinson |"If I quote myself in my .sig, Odd physics professor |can I be a member in good standing National Technical Institute for the Deaf |of the club? Or is that too VJRNTS@ritvax.isc.rit.edu |recursive?" Vicki Robinson
From: mhensley@netcom.com (Michael Hensley)
Subject: Re: Neener Neener Neener
: In article <1993Nov30.022855.4186@ultb.isc.rit.edu> vjrnts@ritvax.isc.rit.edu writes:
: >"If I quote myself in my .sig, can I be a member in good standing of the club?
: >Or is that too recursive?" Vicki Robinson
^^^^^^^^^^^^^
I'm hoping Vicki will follow-up this post, thus quoting herself quoting herself.
[Official Vicki's-in-my-.sig list deleted]
Has she made the FAQ yet? What about the Guiness Book? I've been enjoying
Vicki's articulate, intelligent postings since I first started reading this
group (and no, it was not AFTER I started posting here). She deserves to be
in the FAQ. If the .sig-virus won't do it, perhaps we can get a UL about her
started?
Michael "made the list TWICE by changing the rest of my .sig!" Hensley
Dana "I'm not Vicki Robinson" Netz
===Dana Netz, Electrical Systems Engineer | "All I know is, everything
===GM/DOE Electrochemical Engine Program | you know is wrong"
===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox
===I understand it is obligitory to mention Vicki Robinson in one's sig
kathy williams
*Whose* name am I supposed to put in my .sig?
Steve Caskey | "Ace barbed-wire hurdler until his tragic
caskey_s@kosmos.wcc.govt.nz | accident" - Hercules Grytpype-Thynne
Disclaimer: My employer doesn't |------------------------------------------
care what I think. | *Vicki Robinson, what hast thou wrought?
Phil
/There's no room on this bicycle for a Vicki Robinson quote!
__o __o __o __o __o __o __o __o __o Enneavelo: Quondam Whomper
_-\<,--\<,--\<,--\<,--\<,--\<,--\<,--\<,--\<,_ Phil Gustafson (_)/----/----/----/----/----/----/----/----/ (_) phil@rahul.net Widely regarded as a thoughtful poster of reliable information since 1984.
That's why you put your name at the bottom. I've got mine (but not Vicki Robinson's, for some reason) in my .signature. --
- Kivi jkshapiro@descartes.uwaterloo.ca
This message is in the public domain.
HI! I'm a .signature virus. Copy me into yours and join the fun!
--
David DeLaney: dbd@(utkux.utcc | panacea.phys | enigma.phys).utk.edu - collect
them all! Disclaimers: AFAIK, *nobody* speaks for U.T.Knoxville (consistently);
Thinking about this disclaimer (or about high energy theoretical particle __
physics) may cause headaches. .sig virus: Vicki Robinson v2.24 \/
Tim "Will bake cookies for food." Dowd
[this is not a .sig (sorry, Vicki)]
Tim "restraintless" Dowd
[Technically, I've never quoted Vicki Robinson in my .sig, not even
the famous "I'm not in anyone's .sig" statement. Oh, ah, well,
never mind then.]
Alex "the Speaker is disrecognized for one minute" Cook
K# = 1
|/ | |) /\ "Vicki who?"
(place mirror here)
Jon "Not in Vicki Robinson's .sig." Papai
"Joltin' Joe has left and gone away."
-Vicki Robinson
Vicki Robinson |"If I quote Jon Papai in my .sig, Odd physics professor |can he be a member in good standing National Technical Institute for the Deaf |of the club? Or is that too VJRNTS@ritvax.isc.rit.edu |recursive?" Vicki Robinson
--
John Switzer | It'll be a cold day in hell before
| my sig mentions Vicki Robinson!
Internet: jrs@netcom.com |
CompuServe: 74076,1250 |
Jon "Is Vicki Robinson really an incarnation of KIBO?" Papai
Rick "Oh, no! My .sig has mutated!" Kitchen
--
Rick Kitchen ap974@yfn.ysu.edu
"But I'm not in anyone's .sig"
--Vicki Robinson
Eddie
--
Pixel-planes research group Ten Million Polygons Per Second Or Bust! "But I'm not in anyone's .sig" -- Vicki Robinson, Odd Physics Professor
--
ted frank | "Danger, Vicki Robinson, Danger!" -- Twiki the Robot in 'Lost
the u of c | in Space,' a television show clearly superior to Star Trek.
law school | Tell your site: "I want my a.t.f.t^3!" kibo#=0.5 | Standard disclaimers apply
---Bill "does it count if I put Vicki Robinison's name here, or is club
membership restricted to .sig file users?" VanHorne
Alex "sheesh!" Cook
"...my mother..." -Vicki Robinson
Cheers
Andy "I am not a number, I am Vicki Robinson" Wardley
--
_/ , '
_/_/_/_/ _/_/_/_/ _/ _/ -o O- Andy Wardley
_/ _/ _/ _/ _/ _/ _/ L abw@oasis.icl.co.uk
_/_/_/_/ _/_/_/_/ _/ _/ - Voice: +44 (0)344 473174
Jon "Usenet: A nice place to visit, but nobody lives there." Papai
--
"If I really wanted to read this much whining, I'd peruse
alt.society.generation-x." -Me , not Vicki Robinson
--
kathy
| *Vicki Robinson* - There, I've done my part! |
Rogers
... Vicki who?
___ Blue Wave/QWK v2.12
Lee "me, Vicki Robinson, and the Rolling Stones: only in it for the money" Rudolph
--
yet another Dave
(That Vicki Robinson! What a wonderful person! Now I won't be
decapitated!)
From: derek@nezsdc.icl.co.nz (Derek Tearne)
Subject: Re: Smilies
In article <CHBvrn.88r@undergrad.math.uwaterloo.ca> jkshapir@undergrad.math.uwaterloo.ca (Kivi Shapiro) writes:
>That's why you put your name at the bottom. I've got mine (but not
>Vicki Robinson's, for some reason) in my .signature.
>--
>- Kivi jkshapiro@descartes.uwaterloo.ca
> This message is in the public domain.
>HI! I'm a .signature virus. Copy me into yours and join the fun!
Do it, do it now. Don't stay with those tired old 1991 .signature
viruses, get with it get 1993's up to the minute shiny new .signature
virus.
You know it makes sense...
--
Derek Tearne. -- derek@nezsdc.icl.co.nz -- Fujitsu New Zealand --
______ This is a Usenet Condom<tm>. Roll the condom over the .signature
______} file before posting to protect yourself from .signature retro-virii
CAUTION: Vicki Robinson is now in 20% of all AFU posters .sigs
Dave "vicki robinson virus escaped from .sig and infecting message" Budd
--
It seems very odd to give a bundle of vague sensory perceptions a name
However: Dave Budd,MCC,Oxford Rd,Manchester,England 061-275-6033(fax6040)
D.Budd@mcc.ac.uk (Densa's mole in Mensa [or was it vice-versa?]) Juggle!
GAT d-- p-- c++ l u(---) e+(*) m+/m- s/+ n+(---) h--- f? g+ w+ t+ r(poker) x+
Regards
Ray "Christmas tuba concert in Denver tomorrow night -- wish I could go" Depew
Integrated Circuits Business Division
Hewlett Packard Co, Fort Collins, Colorado
rrd@hpfiqa.fc.hp.com
Vicki Robinson is not in my .sig
t "newbie hacker -- ROTFL-L-L" c
--
( )_( ) __________ DENNYZEN@delphi.com ____________
\. ./ :just another middle-aged Denny Zen of the net:
__=.=__ - aka: splinter - " My .sig does *not* mention Vicki Robinson
Disclaimer: No blatant spoilers for newbies, pandering to whiners, kindness to the chronologically impaired, or references to the new net.goddess Vicki appear in this post. Dave "DOWW!" Ripton
David "yet another Dave" Thomas
--
"But I'm not in anyone's .sig." -- Vicki Robinson
K "ask me about my Vicki Robinson Choco-Chip cookies" G
Tim "I particularly liked the bit about legs on the desk." Dowd "Well, AFU isn't a church..."--V. Robinson
From: jkshapir@undergrad.math.uwaterloo.ca (Kivi Shapiro)
Subject: Re: Smilies
In article <1993Dec3.054701.20949@nezsdc.icl.co.nz>,
Derek Tearne <derek@nezsdc.icl.co.nz> wrote:
>In article <CHBvrn.88r@undergrad.math.uwaterloo.ca>
>jkshapir@undergrad.math.uwaterloo.ca (Kivi Shapiro) writes:
>>That's why you put your name at the bottom. I've got mine (but not
>>Vicki Robinson's, for some reason) in my .signature.
>>--
>>- Kivi jkshapiro@descartes.uwaterloo.ca
>> This message is in the public domain.
>>HI! I'm a .signature virus. Copy me into yours and join the fun!
>Do it, do it now. Don't stay with those tired old 1991 .signature
>viruses, get with it get 1993's up to the minute shiny new .signature
>virus.
Okay. I've cleared out the old one now (I think). Now I just leave
it and see if Vicki Robinson moves in with me?
That didn't come out quite right...
--
- Kivi
Vicki Robinson |"If I quote Derek Tearne in my .sig, Odd physics professor |can he be a member in good standing National Technical Institute for the Deaf |of the club? Or is that too VJRNTS@ritvax.isc.rit.edu |recursive?" Vicki Robinson
From: sorgatz@avatar.tti.com (Erik Sorgatz)
Subject: HAve you ever got it screwed up!(was: Re: NSA CAN BREAK PGP ENCRYPTION
In article <1993Dec2.124258.28542@midway.uchicago.edu> thf2@midway.uchicago.edu writes:
>--
>ted frank | "Danger, Vicki Robinson, Danger!" -- Twiki the Robot in 'Lost
>the u of c | in Space,' a television show clearly superior to Star Trek.
>law school | Tell your site: "I want my a.t.f.t^3!"
>kibo#=0.5 | Standard disclaimers apply
First off, the phrase is:
"Danger! Will Robinson, DANGER!" this line is credited to the robot of
'Lost in Space' but the robot WASN'T named Twiki! In fact the robot
NEVER had a name. He was ONCE called 'Hero' in an early episode, the
Heath Co. then introduced a kit robot bearing the same name. Irwin
Allen Productions claimed "It's not our robot!".
There never was a Vicki Robinson...at least in Lost in Space. And the "Twiki" character was from "Buck Rogers"! ...I notice you're attending a Law University...I somehow doubt I'd be very interested in having an attorney that's as scrambled upstairs as you seem to be!
From: lrudolph@black.clarku.edu (Lee Rudolph)
Subject: Re: HAve you ever got it screwed up!(was: Re: NSA CAN BREAK PGP ENCRYPTION
In a masterful post, sorgatz@avatar.tti.com (Erik Sorgatz) sees Ted one
Vicki Robinson and raises him a Buck Rogers. The question is, does
Citicorp know he's cross-posting to alt.politics.radical-left?
>-Avatar-> (aka: Erik K. Sorgatz) KB6LUY +----------------------------+
>TTI(es@soldev.tti.com)or: sorgatz@avatar.tti.com *Government produces NOTHING!*
>3100 Ocean Park Blvd. Santa Monica, CA 90405 +----------------------------+
>(OPINIONS EXPRESSED DO NOT REFLECT THE VIEWS OF CITICORP OR ITS MANAGEMENT!)
Actually, does Avatar?
Lee "Avatar, low nicotine, full flavor" Rudolph
Paul "Then who's that person we keep quoting in our sigs?" Tomblin
--
Paul Tomblin - AFU's official "Snide Canadian"
Formerly pt@geovision.gvc.com - now available as ptomblin@gandalf.ca
Vicki Robinson was in my sig, but I took her out.
From: vjrnts@ritvax.isc.rit.edu (Vicki Robinson)
Subject: Re: HAve you ever got it screwed up!(was: Re: NSA CAN BREAK PGP ENCRYPTION
In article <1993Dec3.233006.20103@ttinews.tti.com>, sorgatz@avatar.tti.com (Erik Sorgatz) writes:
>In article <1993Dec2.124258.28542@midway.uchicago.edu> thf2@midway.uchicago.edu writes:
>>--
>>ted frank | "Danger, Vicki Robinson, Danger!" -- Twiki the Robot in 'Lost
>>the u of c | in Space,' a television show clearly superior to Star Trek.
>>law school | Tell your site: "I want my a.t.f.t^3!"
>>kibo#=0.5 | Standard disclaimers apply
> First off, the phrase is:
> "Danger! Will Robinson, DANGER!" this line is credited to the robot of
> 'Lost in Space' but the robot WASN'T named Twiki! In fact the robot
> NEVER had a name. He was ONCE called 'Hero' in an early episode, the
> Heath Co. then introduced a kit robot bearing the same name. Irwin
> Allen Productions claimed "It's not our robot!".
> There never was a Vicki Robinson...at least in Lost in Space.
Hey! Hey! Hey! I *deeply* resent that remark! Not only that, I have a
sister named Debbie. 250 Shergolds to the first email correctly identifying
LIS's Debbie Robinson.
Wow! Ted! Way to go, guy! You even got a personal insult out of this one!
I think we have to subtract half a point for all the cross-posting, as that
lowers the difficulty level, but still, a sterling achievement. From one
South-side Chicagoan (past tense) to another (present), I salute you!
And Erik? A little reconstructive surgery will take care of those hook scars
very nicely. Insurance should cover it. Be careful with those barbs, now,
eh? Don't discard them where children can find them.
Vicki "I'M ALIVE !!!!!!!!!!!!!!!!!" Robinson
From: jaskew@maths.adelaide.edu.au (Joseph Askew)
Subject: Re: HAve you ever got it screwed up!(was: Re: NSA CAN BREAK PGP ENCRYPTION
In article <1993Dec4.145633.20779@ultb.isc.rit.edu> vjrnts@ritvax.isc.rit.edu writes:
>In article <1993Dec3.233006.20103@ttinews.tti.com>, sorgatz@avatar.tti.com (Erik Sorgatz) writes:
>> There never was a Vicki Robinson...at least in Lost in Space.
>Hey! Hey! Hey! I *deeply* resent that remark! Not only that, I have a
>sister named Debbie. 250 Shergolds to the first email correctly identifying
>LIS's Debbie Robinson.
Wasn't she the one who went on to make Porn movies?
"Debbie does Alpha Centuari"?
--
Paul Tomblin - AFU's official "Snide Canadian"
Formerly pt@geovision.gvc.com - soon to be ptomblin@gandalf.ca
Vicki Robinson was quoted in my sig, but I took her quote out.
--
Stuart Derby | What's Jonathon Papai doing in Vicki Robinson's .sig? sderby@bcm.tmc.edu | My Kibo number is 2, what's yours?
"There's no need to bother everyone with your ignorance."
--
O O (Derek Tearne - derek@nezsdc.fujitsu.co.nz - Fujitsu NZ). [+] [+] Run for your lives. Phil and Peter are coming straight
| | out of your screen on enormous velocipedes and there's no
| | room for brakes or Vicki Robinson quotes.
|joltes@husc.harvard.edu Manager, Microcomputing and Hardware, Computer Services|joltes@husc.BITNET Harvard University Science Center |
--
ted frank | "There never was a Vicki Robinson" -- Citicorp's Erik Sorgatz
the u of c | "Mom said she'd fix those butter sticks rolled in Kool-Aid
law school | you like so much." -- Mark O'Donnell
kibo#=0.5 | Standard disclaimers apply
---Bill "and don't call me Shirley" VanHorne
---Mark "who's Vicki Robinson?" Phaedrus
From: caskey_s@ix.wcc.govt.nz
Subject: Re: Order of Magnitude, man! (was: that'd be in the buttofuoco, Joey)
In article <1993Dec4.040935.11916@midway.uchicago.edu>, thf2@kimbark.uchicago.edu (Ted Frank) writes:
[in his sig]
>ted frank | "There never was a Vicki Robinson" -- Citicorp's Erik Sorgatz
This _must_ mean Vicki is now one of the AFU Undead. In record time, no less.
Steve "alive and kicking" Caskey
Cosma "Kill-filed hundreds, if not thousands" Shalizi
--
"Death to the Robinson .sig virus!"
Andy "I used to have a front suspension" Lange
(Do I get partial credit for mentioning a certain Professor of Odd Physics?)
--
Andy
t "bailiff from Cardiff via what-if?" c
--
.sig OUT OF ORDER. Please use Vicki Robinson's for the time being.
From: dennyzen@news.delphi.com (DENNYZEN@DELPHI.COM)
Subject: Re: Just what is a nerd?
vjrnts@ritvax.isc.rit.edu (Vicki Robinson) writes:
>In article <2dqbof$m2t@news.delphi.com>, dennyzen@news.delphi.com (DENNYZEN@DELPHI.COM) writes:
>>We've been calling ourselves and others nerds in a few threads
>>here this week. Do we have a definition of this word that we
>>t "knows C but has also owned/ridden a Hawg" c
>Heinous? According to the new FAQ (and darling Jay) that's *my* picture in the
>dictionary next to the entry for "nerd."
>How heinous could it be?
>Vicki "...and take my word for it, I'm, like, rully rully foxy. For a, um,
>'mature' net.goddess." Robinson
Oh, Vicki, Vicki, Vicki, all of my civilian training and will power
can not overcome my net.impulsiveness ...
GIF! GIF! GIF!
(Phew -- glad that's over!)
For the record, Hawg does *not* refer to Ms. R.
t "nor is Buddy Seat a famous drummer" c
--
( )_( ) __________DENNYZEN@delphi.com ____________
\. ./ :just another middle-aged Denny Zen of the net:
__=.=__ - aka: splinter KN 9.98E-01 " Vicki Robinson is mentioned *above* my .sig
K "currently assuming that Vicki Robinson does not use green marking pens" G
From: PAPAI@kcgl1.eng.ohio-state.edu (Jonathan Papai)
Subject: Re: MOTTO? What's it mean?
sderby@crick.ssctr.bcm.tmc.edu (Stuart P. Derby) writes:
> ------------------------------------------------------------------------
> Stuart Derby | What's Jonathon Papai doing in Vicki Robinson's .sig?
Since I have the highest bid so far for her and her children,
I guess she feels obligated to mention me in some way.
By the way, I understand she is still accepting bids, and,
as I may not be able to come up with the cash, I hope
someone will outbid me.
Jon "I own a ruler, and I know how to use it" Papai
Jean-Marc "I'm absolutely certain someone will mention the signification
of furrfu in his reply" Libs
--
Member of the Vicky Robinson-free .sig Owners Club
This message was coded by ROT0, the fastest encryption device to date
Nancy G. from Boston
So I'm from Delphi, flame if you must...
Is this where I have to mention Vickie Robinson?
Greg "Vicki Robertson in her VR goggles, perchance?" Franklin --
Greg Franklin "If it's not on the net, franklig@gas.uug.arizona.edu it's not important."
From: klg@mookie.mc.duke.edu (Kim Greer)
Subject: Re: I feel like sharing today!
In article <CHJLs3.1G6@freenet.carleton.ca> ab401@freenet.carleton.ca writes:
>Paul Tomblin - AFU's official "Snide Canadian"
>Formerly pt@geovision.gvc.com - now available as ptomblin@gandalf.ca
>Vicki Robinson was in my sig, but I took her out.
It may be possible that VR may become the focal point of a whole new set
of net-pranksterism, a mutation from telephone misuse. Imagine the
following email exchange:
userA: "Do you have Vicki Robinson in your .sig?"
userB: "Yes."
userA: "Well, let her out - she's late for work!"
K "could've been a Janitor in a Drum" G
--
My Kibo number is 2, what's yours?
--
John Switzer | Is not putting Vicki Robinson in
| your sig considered sexual harassment?
Internet: jrs@netcom.com | Future Supreme Court Justice nomineees
CompuServe: 74076,1250 | might want to take heed.
From: parkerd@mcmail.cis.mcmaster.ca (Diana Parker)
Subject: names (was:Winston Churchill Fantasies)
> I understand it is obligitory to mention Vicki Robinson in ones sig
Vicki Robinson? I would if I could, but I can't so I won't. Manditory
work .Sig follows.
--
Security Services CUC - 201 McMaster University (905) 525-9140 (x24282)
I quoted Vicki in a ".sig" _at_least_ as far back as November 24th, why didn't *I* make the list?
Bob "just another single male AFU old-hat" O`Bob
--
"But I'm not quoted in anyone's .sig." -- Vicki Robinson
Terry "Will Robinson for Food" Monks
--
Terry Monks Automata Design Inc (703) 742-9400
[whatever the From: says, respond to tel@adiva.com]
From: dbd@martha.utcc.utk.edu (David DeLaney)
Subject: Re: Sick and Tired of MOTTO,MOTTO!!
ObTotallyUnrelatedThread: Since the only thing keeping Vicki Robinson alive
appears to be Derek Tearne (how does that work, anyway, Vicki? I get this
mental picture of an ftp protocol for mouth-to-mouth rescusitation...), can
anyone go ahead and dispose of Derek, as he doesn't seem to be looking right
now (time difference from New Zealand, y'know) - I tried once, but he avoided
the blow neatly by bringing in the Chinese vampires...
ObUL: Derek has survived this long only because it's actually tomorrow in New
Zealand when most of us post, thus necessitating a time-travel paradox - we'd
have to have confirmed his death yesterday...
Dave "will not do mouth-to-mouth on Vicki and eat food simultaneously" DeLaney
Eddie
--
Craig Shergold is an 8 year old boy dying of a brain tumor who's one wish is to
get into the Guiness Book of World Records for receiving the most signatures
with Vicki in them. Put her in yours and mail it to shergold@wish.org.us (Make
A Wish Foundation) "But I'm not in anybody's .sig" ---Vicki Robinson
Tim "Will bite on worms when trolled. Ow." Dowd Well, AFU isn't a church... V. Robinson
--
Jason R. Heimbaugh - jrh@uiuc.edu
The original cherry bustin' version:
"But I'm not in anyone's .sig." --Vicki Robinson
From: rrd@fc.hp.com (Ray Depew)
Subject: The .sig girl makes the movies
Well, you all, I thought you would like to know that all of us who are
appearing for free in newspapers and on talk shows are stooooooopid. I
was watching "The Parent Trap" with my kids this weekend, and I sat up
and took notice when the dad's new girlfriend was introduced -- no,
not because of that, silly, but because of her name.
She was "Vicki Robinson." And lemme tell ya, if you're one of the lonely
bachelors still bidding on this young lady, two-fifty is not nearly enough.
Sorry, any cries of "GIF! GIF! GIF!" will have to go unfulfilled. I don't
have access to a frame grabber.
Regards
Ray Depew
From: NENANCY@delphi.com
Subject: Re: Conversation or correspondence... (was Re: AFU wiseguys, MOT
Close. Not Joyce *OR* Homer, but Swift.
Not all Delphites are uneducated.
Although some of us can't spell Vicki Robinson's name properly.
Tom "I put 'Joltin' Joe' in my .sig as a tribute to the late, great Vicki Robinson, but Lee Rudolph lopped off the attribution" Madden
Jon "No celebrity organ articles." Papai
--
nosniboR ikciV- ".gis. s'ydobyna ni ton m'I"
Regards
Ray Depew
Integrated Circuits Business Division
Hewlett Packard Co, Fort Collins, Colorado
rrd@hpfiqa.fc.hp.com
I stubbornly refuse to put Vicki Robinson in my .sig.
--
From: vjrnts@ritvax.isc.rit.edu (Vicki Robinson)
Subject: Re: Solicitors from HELL!!
In article <CHMJ6n.BLG@undergrad.math.uwaterloo.ca>, rkleitma@undergrad.math.uwaterloo.ca (Rob Leitman) writes:
>----------------------------------------------------------------------
>Robert | I don't actually have a .sig, I just | What ever happened
>Leitman | wanted to put Vicki Robinson in here. | to snopes?
And did you notice that this Vicki character showed up about the same time
that snopes disappeared? Has anyone ever seen them in the same place at the
same time? Does anyone even know what this Vicki looks like, anyhow?
Vicki "Rumors of my nonexistance have been greatly exaggerated, but that's all
I have to say." Robinson
From: dondd@sr.hp.com (Don Dillon)
Subject: Who is this Vicky chick???
Yeah, thats right. I'm calling you down on the table Miss Vicky, or whoever
you really are. What kind of evil communist plot have you instigated by
subverting your namesake into the .sig's of a vast majority of AFU's
posters??? What pinko, tree hugging, liberalist scheme has that tiny little
brain of yours conjured up to subtrafuge the sanctity of our cozy little
newsgroup. Are you a real person? A virus? A random newsbot? or are you
just a LEGEND that won't die?!?!?!?
--
- Kivi
jkshapir@descartes.uwaterloo.ca (Kivi Shapiro)
Vicki Robinson won't be in this .sig 'til July 1996.
This message is in the public domain.
Ray "1,3,5,7,..." Sachs
Who has no .sig file
which consequently doesn't not contain Vicki Robinson
--
Michael D. Hensley | It will be a cold day in heck before I follow-up mhensley@netcom.com | a Ted Frank troll^H^H^H^H^Hpost.
70700.763@compuserve.com | Vicki Robinson quoted removed -- my wife kept Prodigy: yeah, right. | asking who this Vicki person was.
From: vjrnts@ritvax.isc.rit.edu (Vicki Robinson)
Subject: Re: The .sig girl makes the movies
In article <CHMq9x.It2@fc.hp.com>, rrd@fc.hp.com (Ray Depew) writes:
>Well, you all, I thought you would like to know that all of us who are
>appearing for free in newspapers and on talk shows are stooooooopid. I
>was watching "The Parent Trap" with my kids this weekend, and I sat up
>and took notice when the dad's new girlfriend was introduced -- no,
>not because of that, silly, but because of her name.
>She was "Vicki Robinson." And lemme tell ya, if you're one of the lonely
>bachelors still bidding on this young lady, two-fifty is not nearly enough.
>Sorry, any cries of "GIF! GIF! GIF!" will have to go unfulfilled. I don't
>have access to a frame grabber.
Hey, what can I say? I quit acting to make some *real* money as a college
prof.
Vicki "It was that Sally Struthers ad: 'Would you like to make more money?
Sure! We all would!....' that led me fatefully to grad school." Robinson
Bob "no hooks here, I really believe this" O`Bob
--
"But I'm not quoted in Vicki Robinson's .sig!"
From: dw@unislc.slc.unisys.com (Dan Wright)
Subject: Re: FAQ
OBMention: rot(Ivpxv)
--
/|/-\/-\ In real life, the Vice President chastises Vicki Robinson |__/__/_/ for her morals. Bill Clinton plays the sax on "Arsenio |warren@ Hall." Though "Batman Returns" is fiction, it's not too
/ nysernet.org much stranger than truth - Caryn James, The New York Times
Bob O`Bob
--
"Yes, Veronica, there is a Vicki Robinson..."
From: rrush1@bach.helios.nd.edu (Richard L. Rush)
Subject: Re: Who is this Vicky chick???
In article <CHMxD2.5G9@srgenprp.sr.hp.com>, dondd@sr.hp.com (Don Dillon)
wrote:
> Yeah, thats right. I'm calling you down on the table Miss Vicky, or whoever
> you really are. What kind of evil communist plot have you instigated by
> subverting your namesake into the .sig's of a vast majority of AFU's
> posters??? What pinko, tree hugging, liberalist scheme has that tiny little
> brain of yours conjured up to subtrafuge the sanctity of our cozy little
> newsgroup. Are you a real person? A virus? A random newsbot? or are you
> just a LEGEND that won't die?!?!?!?
None of the above, she is a NET- prophet (TM) in training.
We are looking forward to the day that the newsgroup
alt.religion.vickiism is born.
(Do you think he bought it Vicki? If so please remove the
Uzi from my ribs.)
Rich " A prophet is never welcome in their own newsgroup" Rush
From: vjrnts@ritvax.isc.rit.edu (Vicki Robinson)
Subject: Re: Who is this Vicky chick???
In article <CHMxD2.5G9@srgenprp.sr.hp.com>, dondd@sr.hp.com (Don Dillon) writes:
>Yeah, thats right. I'm calling you down on the table Miss Vicky, or whoever
>you really are.
No, no, you're thinking of Tiny Tim's ex-wife. My ex- was a little strange,
but Tiny Tim he was not.
>What kind of evil communist plot have you instigated by
>subverting your namesake into the .sig's of a vast majority of AFU's
>posters???
Um, can one "subvert" into something? Do I have a namesake? Hey, they asked
for it.
>What pinko, tree hugging, liberalist scheme has that tiny little
>brain of yours conjured up to subtrafuge the sanctity of our cozy little
>newsgroup.
Tiny!? I resent that remark!
>Are you a real person?
Yes, although I have my own kind of virtual reality. Me 'n Mel.
>A virus?
I've been known to get under one's skin.
>A random newsbot?
Hey, aB may be smart, but he's not THAT good!
>or are you
>just a LEGEND that won't die?!?!?!?
Hey! Gimme a break! I've asked Derek, Joseph Askew has nominted me, and Dave
Delaney seconded the motion, but Mr. Tearne remains intransigent. But that's
ok. It's good to have goals in life.
>-----------------------------------------------------------------
>Don {personally, I think she is really Kibo come out of the closet} Dillon
I can't deny that Kibo and I have never been seen together publicly.
Vicki "Seeing the dark side of fame for the first time." Robinson
Vicki Robinson |I don't think Kibo has a .sig, does Odd physics professor |he? And who is Don Dillon, and why National Technical Institute for the Deaf |is he saying those things about me? VJRNTS@ritvax.isc.rit.edu |And why did he spell my name wrong?
Aric "UNALTERED dissemination OF THIS important InFoRmAtIoN..." TenEyck
--
=You know whose opinions these are and whose they aren't=
I'll allude to the woman, but I won't mention her name in my .sig!
From: derek@nezsdc.icl.co.nz (Derek Tearne)
Subject: Re: motto
In article <1993Dec5.032515.15222@martha.utcc.utk.edu> dbd@martha.utcc.utk.edu (David DeLaney) writes:
>Ok, serious (ha!) UL question: What's the VR .sig virus up to numberwise by now?
>Can the keeping-track person issue an interim report?
I don't know about numbers actually quoting in .signature files but, out
of 664 articles currently on the spool directory (we expire AFU after 3 days
becuse it's just too big...) 264 mentioned Vicki by name, After a little
massaging with sort -u and deleting Vicki's own posts there were 102 seperate
and unique mentions of her name. That's not counting the people who
mention Vicky Robertson and any clever dicks who might have rot-13'd it.
That's a lot of obsessed AFU'ers.
Of course I would never be caught up in such a trivial pastime as quoting
someone else in one of my .sigs
Derek "We are VICKI YOU will be ASSIMILATED" Tearne
--
Wes Morgan ----- University of Kentucky ----- morgan@engr.uky.edu Mailing list for AT&T StarServer E/S admins - starserver-request@engr.uky.edu
GCS/E/MU d--- -p+ c++ l+ m* s++/++ !g w+ t+ r And here's to you, Vicki Robinson; Usenet loves you more than you will know.
Dale "Is this where I'm supposed to mention Vicky Robinson?" Miller
Glenn "You too Vicki" Moulaison
--
Paul Tomblin - AFU's official "Snide Canadian"
How many times can a Vicki Robinson reference mutate before it becomes lame?
Vicki "I'll have a Tearne on toast, please, with hot tea." Robinson
Vicki Robinson |Bob O'Bob will get a quote in my Odd physics professor |.sig when he learns to spell my National Technical Institute for the Deaf |name. VJRNTS@ritvax.isc.rit.edu |
--
Rick Kitchen ap974@yfn.ysu.edu
I never saw Vicki Robinson, I expect I'll never see her,
But I can tell you anyhow, I'd rather quote than be her.
From: phaedrus@halcyon.com (Mark Phaedrus)
Subject: Re: Net.loons
In article <2e2j59$s49@vixen.cso.uiuc.edu>, catstyle@gofish.aiss.uiuc.edu
(Jason R. Heimbaugh) wrote:
> Jon Papai (3), Diana Parker, Mark Phaedras, Dave Ripton, Vicki Robinson (4),
> ---Mark "who's Vicki Robinson?" Phaedrus
FURRFU! I'm sitting here, about to be executed, and what sympathy do
I get? I get to see my name misspelled, when my first cute/witty/funny
attempt at a Vicki Robinson .sig is actually _in the file_! Oh, misery
upon misery...
--- Mark "where's a titanium collar when you need one?" Phaedrus
--
\o\Internet: phaedrus@halcyon.com (Seattle, WA Public Access Unix)\o\
\o\ Currently on Death Row, A.F.U. Penitentiary, Smiley Division \o\
\o\"I promise I'll come to your execution, though" --Vicki Robinson\o\
From: ab401@freenet.carleton.ca (Paul Tomblin)
Subject: Re: Isn't MC Donald S a rapper?
derek@nezsdc.icl.co.nz (Derek Tearne) writes:
>--
> O O (Derek Tearne - derek@nezsdc.fujitsu.co.nz - Fujitsu NZ).
> [+] [+] Run for your lives. Phil Gustafson and PvdL are turning
> / / a really tight corner on a wet slippery .sig . Those big
> / / velocipedes are _really_ unstable and they CAN'T STOP!!!
Hey! Who gave you permission to mutate your signature without including
Vicki Robinson?
Paul "Is it live, or VR?" Tomblin
--
Paul Tomblin. -- ab401@freenet.carleton.ca - National Capital Freenet --
Some of the more environmentally aware dinosaurs were worried about the
consequences of an accident with the new Iridium enriched fusion reactor.
"If it goes off only Vicki Robinson and Derek Tearne will survive..." they said.
--
Paul Tomblin. -- ab401@freenet.carleton.ca - National Capital Freenet --
Some of the more environmentally aware posters were worried about the
consequences of an accident with the signature file generator.
"If it goes off only Vicki Robinson quotes will survive..." they said.
--
Greg Franklin "Vicki Robinson...unreasoning vanity!" franklig@gas.uug.arizona.edu -- Winston Churchill, _The Celebrity_
Paul "my first post here, so I won't quote Vicki Robinson" Peterson
Luke "I may be crazy, but then again Im insane" Vaughn
John "how come you didn't ask about the traffic signals on the
freeway entrance ramps?" Van "since my last name has two parts,
I can reserve this space to mention Vicki Robinson" Essen
From: vera2@netcom.com (David Adams)
Subject: Re: Net.loons
catstyle@gofish.aiss.uiuc.edu (Jason R. Heimbaugh) writes:
>The "But I'm not in anyone's .sig." --Vicki Robinson FAQ
>========================================================
Much Garbage Deleted...
I can't believe you guys wasting all this net bandwith on silly
childesh signature games. If the NSA realizes how much garbage
you are sending out on its backbone they will likely pull thier
funding! I though this group was for serious discussions of
U.L.'s!
--
| | Note: The above message is encrypted with | | David Adams | the new NSA unbreakable PFGP plain-text- | | vera2@netcom.com | in/plain-text-out system. The above | | | message only appears to say what it says.| | 'Bob Wills Lives' | PFGP KEY: XyZZYvICkiAroBINsOniSinOTOiNPtHISE | | | sIGLubREaKBLeRBIThISkNErlNSaKLAeTU |
From: franklig@helium.gas.uug.arizona.edu (Gregory C Franklin )
Subject: Re: Net.loons
In article <vera2CHpG7q.3Ev@netcom.com>, David Adams <vera2@netcom.com> wrote:
>catstyle@gofish.aiss.uiuc.edu (Jason R. Heimbaugh) writes:
>>The "But I'm not in anyone's .sig." --Vicki Robinson FAQ
>>========================================================
>I can't believe you guys wasting all this net bandwith on silly
>childesh signature games. If the NSA realizes how much garbage
>you are sending out on its backbone they will likely pull thier
>funding! I though this group was for serious discussions of
>U.L.'s!
This has got to be a troll.
1) obvious, obvious misspellings
2) repeats the conception that the NSA funds the net
3) prim acronymization "U.L."
4) goofy 8-line signature mentioning PGP
5) no evident awareness of the entire previous week of AFU postings
and last but not least
6) not from PSUVM or DELPHI
This guy is more clever than he lets on. Oh well, consider me hooked.
Greg "would I taste better broiled or fried? Please advise" Franklin
Aric TenEyck
--
=You know whose opinions these are and whose they aren't=
I'll allude to her, but I will not speak her name in my .sig!
(or type it for that matter)
--
Jim "Will unscrew metal plates for Vicki Robinson" Finnis
Lee "will ask an expert for advice if she's VR" Rudolph
Josh "Vicki who?" Munn
Jodi "...Ms. Robinson, Internet loves you more than you will know!" Giannini (do I get any points for that?)
--
Antony Cooper -- Internet: acooper@nuustak.csir.co.za (25 45S 28 16E)
CSIR Information Services, PO Box 395, Pretoria, 0001, South Africa
Voice: +27 12 8414121 $ Fax: +27 12 8413037 $ Page: (012) 3417607 code 32091
So, just who is this Vicki Robinson, anyway?
These are my opinions only!! Goodnight, Vicki Robinson,
wherever you are.
>Glenn "You too Vicki" Moulaison
Derek "Touch our Vicki and you're a dead man" Tearne
--
O O (Derek Tearne - derek@nezsdc.fujitsu.co.nz - Fujitsu NZ).
[+] [+] Run for your lives. Phil Gustafson and PvdL are turning
/ / a really tight corner on a wet slippery .sig . Those big
/ / velocipedes are _really_ unstable and they CAN'T STOP!!!
--
O O (Phil Gustafson - phil@rahul.net) [+] [+] Run for your lives. Phil Gustafson and PvdL are chasing Vicki
/ \ Robinson on their enormous unstable velocipedes, and one of / \ them can't find Rochester! Or even Mel Blanc!
From: thf2@kimbark.uchicago.edu (Ted Frank)
Subject: Re: Isn't MC Donald S a rapper?
In article <lrudolph.755386401@black.clarku.edu> lrudolph@black.clarku.edu (Lee Rudolph) writes:
> O O (Lee Rudolph - lrudolph@clarku.edu - Worcester MA).
> [+] [+] Run for your lives. PWPAXTON and vfont are turning
> _/_ _/_ a really tight corner on a wet slippery .sig . Even
> // / // /
Uh, Lee, in case you haven't heard, December is "Isles of Langerhans"
month, and *that's* the body part you should be exaggerating in your
ASCII art.
Ted "will trade food for a GIF of Vicki Robinson's Langerhans" Frank
Aaron "understood every word of Dubliners (Reader's Digest
Condensed Version, that is)" Bardhart
--
"You can stop promoting Vicki Robinson now. Another
female has joined the group." -- Mrs. Doubtfire
Subject: AFU Toronto? When is it?
From: dan.mckinnon@canrem.com (Dan Mckinnon)
AB>Paul Tomblin - AFU's official "Snide Canadian"
AB>Formerly pt@geovision.gvc.com - now available as ptomblin@gandalf.ca
AB>Vicki Robinson was in my sig, but I took her out.
And what's she like on a date, Paul? Dan "On a scale of 1 to 10" McKinnon I don't have a sig, so I can't mention Vicki Robinson. ---
From: jrs@netcom.com (John Switzer)
Subject: Re: Winston Churchill Fantasies
In article <mhensleyCHqFt3.8yK@netcom.com> mhensley@netcom.com (Michael
Hensley) writes:
>--
>Michael D. Hensley | It will be a cold day in heck before I follow-up
>mhensley@netcom.com | a Ted Frank troll^H^H^H^H^Hpost.
>70700.763@compuserve.com | Vicki Robinson quote removed -- my wife kept
>Prodigy: yeah, right. | asking who this Vicki person was.
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ Is there no stopping of Vicki's perfidy? How many more marriages will she destroy and families break-up, all because of her greedy desire to be in ever more sigs? On the other hand, it is heartwarming to think of Michael and his family gathering around the family CRT each evening to read AFU, to chuckle at the musings found there, and to have a good time ridiculing newbies. Ah ... this, my friends, is a family which will endure, in spite of Vicki's malicious sig-hogging. This is family values in action.
Hanna "I'm not mentioning anyone here" Pasula
Doug "I haven't read AFU for a month and I don't know who Vicki Robinson is" Rudoff
------------------------------+-------------------------------------------+
Steve Caskey |you must buy a | AFU Suicide Kit: ) : - |
caskey_s@kosmos.wcc.govt.nz |television derek| [some assembly required] |
Disclaimer: It wasn't me, it | "Vicki Robinson" is an anagram of "Kibo's
must have been someone else. | VR in icon". Coincidence? I think not!
From: ab401@freenet.carleton.ca (Paul Tomblin)
Subject: Re: AFU Toronto? When is it?
dan.mckinnon@canrem.com (Dan Mckinnon) writes:
> And what's she like on a date, Paul?
Yeah, yeah, yeah. I was actually trolling for Vickis, but it didn't work.
And she's not coming to AFU Toronto.
Paul "damn damn damn damn" Tomblin
Paul "Why should I mention Vicki Robinson?" Peterson
--
Jason R. Heimbaugh - jrh@uiuc.edu
"And here's to you, Vicki Robinson/Jesus loves you more than you will know."
--Simon and Garfunkel
From: jtl@netcom.com (Todd Larason)
Subject: Re: Net.loons
vera2@netcom.com (David Adams) writes:
>I can't believe you guys wasting all this net bandwith on silly
>childesh signature games. [Obvious trolling deleted]
Am I the only one who actual read the .sig, or is this trolling that everyone
else saw through, too?
>| 'Bob Wills Lives' | PFGP KEY: XyZZYvICkiAroBINsOniSinOTOiNPtHISE |
>| | sIGLubREaKBLeRBIThISkNErlNSaKLAeTU |
xyzzy Vicki A Robinson Is I Not O In P This E Sig L ubreabkle &c.
--
Todd Larason
jtl@netcom.com
I'm not even sure who Vicki Robinson is.
Aric TanEyck
--
=You know whose opinions these are, and Vicki Robinson's they're not=
Charles "I have never had Vicki Robinson show up in my .sig" Odell
Greg "I wonder if Vicki Robinson would know..." Franklin --
Greg Franklin "Vicki Robinson...unreasoning vanity!" franklig@gas.uug.arizona.edu -- Winston Churchill, _The Celebrity_
--
- Bill Seurer Language and Compiler Development IBM Rochester, MN Business: BillSeurer@vnet.ibm.com Home: BillSeurer@aol.com
Only you can prevent Vicki Robinson sigs!
--
Terry Monks Automata Design Inc (703) 742-9400
[whatever Vicki Robinson's sig says, respond to tel@adiva.com]
Josh "Vicki sent me e-mail!" Munn
rgds-- TA (tallard@frb.gov)
The opinions expressed in this article are patented by the author.
Vicki Robinson has expressed interest in these views, but I
have yet to grant her a license to use them.
propagate to other newsgroups but,
like a fairy ring fungus, die out in
this one??
From: ap974@yfn.ysu.edu (Rick Kitchen)
Subject: alt.fan.vicki-robinson?
Date: 9 Dec 1993 22:28:33 GMT
I propose that someone with more power than I, newgroup
"alt.fan.vicki-robinson".
Do I see a show of hands?
Rick "Come on, you can do better than that" Kitchen
--
Rick Kitchen ap974@yfn.ysu.edu
I never saw Vicki Robinson, I expect I'll never see her,
But I can tell you anyhow, I'd rather quote than be her.
--
- Bill Seurer Language and Compiler Development IBM Rochester, MN Business: BillSeurer@vnet.ibm.com Home: BillSeurer@aol.com
If Vicki Robinson sigs are outlawed only outlaws will have Vicki Robinson sigs.
Bill 'overbearing tin-plated dictator with delusions of VickiRobinsonhood' Sinkins wsinkins@mbcr.bcm.tmc.edu
From: derek@nezsdc.icl.co.nz (Derek Tearne)
Subject: Re: Isn't MC Donald S a rapper?
In article <CHp31o.1G5@freenet.carleton.ca> ab401@freenet.carleton.ca writes:
>derek@nezsdc.icl.co.nz (Derek Tearne) writes:
>
>>--
>> O O (Derek Tearne - derek@nezsdc.fujitsu.co.nz - Fujitsu NZ).
>> [+] [+] Run for your lives. Phil Gustafson and PvdL are turning
>> / / a really tight corner on a wet slippery .sig . Those big
>> / / velocipedes are _really_ unstable and they CAN'T STOP!!!
>
>Hey! Who gave you permission to mutate your signature without including
>Vicki Robinson?
Hey everybody, start a new trend, remove Vicki from your .signatures!!!!
Be the first at your site to have a Vicki free .signature file
>Paul Tomblin - AFU's official "Snide Canadian"
>How many times can a Vicki Robinson reference mutate before it becomes lame?
Depends on whether it injects the venom from a brown recluse spider into
Vicki's leg or not.
Derek "Will suck venom from Vicki's leg for, oh well, never mind" Tearne
--
Derek Tearne. - derek@nezsdc.fujitsu.co.nz - Fujitsu New Zealand -
VirusBlat Version 1: Vicki Robinson .signature virus detected and removed
from file: /home/users/derek/.signature
VirusBlat is a vapourware product. Feel free to distribute it throught the net
Cheers, Simon
______ "His mathematical achievements are too subtle and technical
/ / \ for me to understand or to describe, but I can attest to
/ / \ the strength of his brain because I once saw him, for a
/ / \ bet, drink sixteen martinis in a row and then be still on
/ / /\ \ his feet and quite lucid, though somewhat pessimistic
/ / / \ \ in his utterances." Otto Frisch on John von Neumann
/ / /\ \ \ ____
/ / / \ \ \ | \ Simon Milton, aka Magnificat
/ /__/____\ \ \ | | 1st posting to afu!
/ \ \ \ |____/
/________________\ \ \ | Ceci n'est pas une Vicki Robinson .sig!
\ \ / |_____|
\_____________________\/
From: derek@nezsdc.icl.co.nz (Derek Tearne)
Subject: Re: Call For Loons
In article <CHqzBM.209@acsu.buffalo.edu> v140pxgt@ubvms.cc.buffalo.edu (Daniel B Case) writes:
>Kibo is the sole occupant of the net.god list (Many people have their own
>alt.fan groups, but only one person has his own alt.religion group).
Kibo Smibo.
It took Kibo _years_ of insidious grepping to become noticed, then more
years still before he got his own newsgroup and then even more before
alt.religion.kibology.
That's not very impressive really, after all within only a couple of months
our very own Vicki Robinson has captured the .sigs of a _whole_newsgroup_
someone will probably newgroup alt.fan.vicki-robinson sometime next week
and alt.religion.odd-physics will be newgrouped sometime in the new year.
ObVicki: At least Vicki's named after the robot in Fireball XL-5, clearly
better than ST:TOS, rather than some skummy village on the edge of a
mountain in Tanzania...
Derek "Has driven through Kibo but didn't stop - or even notice in fact" Tearne
================================================================================"I have no intention of making any ageist comments about Vicki's headwear, but I feel quite justified in claiming renewal of my status in the alt.sport.trolling.old-hat hall of fame." Bob O`Bob OK I admit it, he got me. It was damn subtle though. *sigh*
From: klg@mookie.mc.duke.edu (Kim Greer)
Subject: Re: Net.loons
In article <1993Dec8.011527.8781@ultb.isc.rit.edu> vjrnts@ritvax.isc.rit.edu writes:
>Hey, Man, I'm from the Souf Side of Chi-town. Takes a lot to scare a
>home-girl.
>Vicki "Honky" Robinson
Well, thanks Vicki "Honky" Robinson. You're ruining my net-impression of
what you are like. I had you pegged for a rully rully k001 surfer dude-ess
and you go and spoil my fantasy. And on a Friday.
K "can I join your gang now? can-I-huh?" G | I think that I shall never see
| a Robinson as k001 as Vicki.
From: jrs@netcom.com (John Switzer)
Subject: Re: alt.fan.vicki-robinson?
In article <2e88qh$6ll@news.ysu.edu> ap974@yfn.ysu.edu (Rick Kitchen) writes:
>I propose that someone with more power than I, newgroup
>"alt.fan.vicki-robinson".
>Do I see a show of hands?
Think very carefully about what you're doing - do you really want to
turn Vicki into the "Zsa-zsa Gabor of the Internet"? Are you really
that cruel?
I don't put my sexual preference in my sig. Paul "Unless you count the reference to Vicki Robinson" Tomblin
--
David Thomas (david@micro.ti.com) Texas Instruments, Houston "No calculators!" -- Vicki Robinson
--
Terry Monks tel@adiva.com Automata Design Inc (703) 742-9400
[ member VVRR, Virtual Vicki Robinson Reality.]
So, the pulltab is indeed "more pure aluminum" than the rest of the can. --
- Bill Seurer Language and Compiler Development IBM Rochester, MN Business: BillSeurer@vnet.ibm.com Home: BillSeurer@aol.com
I don't see Vicki's name anywhere on the can, however.
Rob | Still no .sig, Vicki | Won't stop | and Predecessor Leitman | Robinson # = 1 | bugging Kivi | Automata
Jon "It really was me and not Vicki." Papai
--
Jason R. Heimbaugh - jrh@uiuc.edu
Vicki Robinson quote removed - Michael Hensley's wife kept asking me who
this Vicki person was...
From: showme!@mizzou1.missouri.edu
Subject: Re: alt.fan.vicki-robinson?
up till now i was sure that if the govt dosed you with some god-forbidden
molecule, it would be obvious. but now i'm not so sure.
if v. robinson is god then this is serious silliness.
From: gateley@siva.upc.es (John Gateley)
---
The "signature virus" is strong evidence that Darwin was wrong: that instead of
evolving from monkeys, we are actually evolved from cows.
Scream it out, Say it loud,
I'm a cow, and I'm proud! MOOO
From: vjrnts@ritvax.isc.rit.edu (Vicki Robinson)
Subject: Re: alt.fan.vicki-robinson?
In article <16CA0DBD4.C622052@mizzou1.missouri.edu>, showme!@mizzou1.missouri.edu writes:
>up till now i was sure that if the govt dosed you with some god-forbidden
>molecule, it would be obvious. but now i'm not so sure.
>if v. robinson is god then this is serious silliness.
No, I'm not. Kibo is. We all know that.
I'm not even close.
No, really.
Vicki "Trust me" Robinson
Subject: SIGalert: .sig rental now available
From: joltes@husc7.harvard.edu (Richard Joltes)
Until last week I'd always thought .sigs were funny but kinda useless. It
was then, however, that I received e-mail from Vicki "net.goddess" Robinson.
Said she: "Wow! I'm in *Dick Joltes'* .sig!? I've really made the big
time now!" (or something to that effect).
This started the wheels turning...and then the patented overhead light bulb
came on.
Announcing: the latest in advertising technology! .SigAds!
Yes, you too can have your slogan or product advertised by a legendary AFU
old hat, Terry, or other net.god! Think of the exposure! For the smallest
fee, your ad (3 lines maximum) can be posted to multiple groups. Just think
how useful it would be to have your favorite phrase splattered across alt.
sex.bestiality, alt.flame.ted-kaldis, or <gasp!> cross posted to alt.religion.
kibology!
There you have it, folks. The ad of the future. Mark my words, in ten years
it'll be ... well, too big to think about!
Or not.
Dick "only two-fifty per line!" Joltes |joltes@husc.harvard.edu Harvard University Science Center |
From: "Len Berlind" <p00881@psilink.com>
Subject: RE: author of "Love Boat" comparison
>DATE: 9 Dec 1993 14:40:28 GMT
>FROM: Jonathan Papai <PAPAI@kcgl1.eng.ohio-state.edu>
>
>I wrote that!
>I believe that would have been about 10 or 12 months ago.
>That article was crossposted to alt.folklore.urban and
>r.a.s.m.
>What issue of _Entertainment Weekly_ would that have been?
>If it is what I wrote, I'll give them permission, if they
>admit who stole it from the net!
>I am not making this up.
Usenet, Love Boat *and* Jonathan Papai?
Alleluia! I have seen the Light!
Didn't Captain Robinson have a teenage daughter? And didn't she get to wear
a neat uniform and everybody liked her but she didn't seem to have a real job,
just did *odd* jobs around the Boat? And every once in a while she'd
get Romantically Involved with a Dreammy Guy but he always turned out
to be a bounder, so it didn't work out? But being the cute spunky kid
that she was, she never let it get her down for too long?
And wasn't her name *Vicki* ?????
^^^^^
One more thing - according to my Canon P-41-D calculator (low tech, but
so am I) her age is just about right.
Len"if I ever figure out how to do a .sig file she'll be in it"Berlind
Alan "AFU is read by sixty billion readers and increasing" Rosenthal ObVicki: "But I'm not in anyone's .sig." -- Vicki Robinson
Alan "if this article were posted to sci.sceptic, it would have to contain a smiley, or the readers wouldn't realize it was a joke. In fact, three smileys in a row is considered even more explicit." Rosenthal ObVicki: Does Vicki Robinson have any Newtonian tendencies?
Alan "never snotty" Rosenthal
ObVicki: I know someone named Vicky who thinks that the spelling "Vicki" is
stupid. But I disagree.
Alan "never ascribe to simple causes what you can make big complicated bullshit
explanations out of" Rosenthal
ObVicki:
Q. At one point, you dropped the Vicki Robinson .signature quotes, then brought
them back. Why?
Q. How do you put the "I'm not in anyone's .sig" on every posting?
-- from the M&M/VR faq
Bob O`Bob
--
I tried not to mention Vicki Robinson one day, and my eyeballs froze
from the evaporation due to the vacuum.
Alan "ok, I admit this posting was more grumpy than required" Rosenthal Alan "but I *like* being grumpy!" Rosenthal ObVicki: Of the 46 postings which contain smilies currently online at my site in sci.physics, none is by Vicki Robinson. Although one is by Christopher Neufeld. But admittedly he was quoting another article, from sci.chem last month. Or so he claims.
Ray "will breed loons for food" Sachs, who has no .sig file, which consequently doesn't not contain V. Robinson.
From: phil@rahul.net (Phil Gustafson)
Subject: Hub Fans Buy Phil Beer
Date: Sat, 11 Dec 1993 20:05:38 GMT
I'm going to be back in Boston for the week with Christmas in the middle.
It's a family time, and scheduling will be tight, but there's a lot of
afu'ers out there I'd like to shake hands with or share a beer with.
Drop me a note if you'd like to put a meeting together.
Phil "And I'll be flying right over Vicki Robinson" Gustafson
And, while we're at it, imagine the harm a "Vickibo" would cause.
From: obrien@netcom.com (No parking EXCEPT FOR BOB)
Subject: Re: Filthy computer games lead to filing for divorce in Israel!
vjrnts@ritvax.isc.rit.edu writes:
>Vicki "Recently finished bandaging up all the hook scars, no longer hungry,
>thanks very much." Robinson
>===============================================================================>"I have no intention of making any ageist comments about Vicki's headwear,
>but I feel quite justified in claiming renewal of my status in the
>alt.sport.trolling.old-hat hall of fame." Bob O`Bob
>OK I admit it, he got me. It was damn subtle though. *sigh*
>===============================================================================Hey! I'm strictly catch-and-release! I use the most humane hooks
I can fabricate! I wouldn't think of scarring my precious Vicki!
It must have been somebody else! Nobody saw me do it, you can't prove...
Oops. Sorry, carried away.
Seriously, I'm honored. If you can ever make it out to an AFU West,
we'd be delighted, none more so than I.
Bob O`Bob
Jean-Marc Rocher
rocher@husc8.harvard.edu
I was told we wouldn't have to mention Vicki Robinson in this newsgroup.
From: flaps@dgp.toronto.edu (Alan J Rosenthal)
--
"I think it's stupid. We collect all these business cards, and it turns out
nobody wants them," student Vicki Robinson said.
Mike "couldn't resist putting in his two-fifty" Edwards
__
Sure sorry I missed out on quoting Vicki Robinson in my .sig.
Bob "Never eat anything bigger than your head" O`Bob
--
"Vicki Robinson isn't a victim, but graciously plays one on the net"
From: wb8foz@skybridge.SCL.CWRU.Edu (David Lesher)
Here's to you, Ms Robinson......
From: sderby@crick.ssctr.bcm.tmc.edu (Stuart P. Derby)
Subject: Re: alt.fan.vicki-robinson?
In article <2e88qh$6ll@news.ysu.edu>, ap974@yfn.ysu.edu (Rick Kitchen) writes:
> I propose that someone with more power than I, newgroup
> "alt.fan.vicki-robinson".
Ummh.. I don't think "fan" is the right sub-hierarchy for the
vicki-robinson group. I mean, look what kind of company she'd be
keeping: David Sternlight, Serdar Argic, Douglas Adams, etc. etc.
Our Vicki deserves better. Other proposed names:
alt..sig.vicki-robinson
alt.virus.vicki-robinson
alt.vr (and we could troll for folks looking for virtual reality)
alt.Im.not.in.anyones.sig (probably too general)
alt.shes.not.in.anyones.sig
alt.vicki-robinson.danger.danger.danger (It's a newsgroup! No, it's
a troll! No, IT'S BOTH!) alt.religion.vr-sigs (Why should Kibo have all the fun! And we
could give a credit of two-fifty for every convert!)
You get the idea.
Stu "Who's this Vicki chick and what's she doing in my .sig?" Derby
From: obrien@netcom.com (No parking EXCEPT FOR BOB)
Subject: Re: alt.fan.vicki-robinson?
In article <2e88qh$6ll@news.ysu.edu> ap974@yfn.ysu.edu (Rick Kitchen) writes:
>I propose that someone with more power than I, newgroup
>"alt.fan.vicki-robinson".
No, it doesn't take "power," unless you ascribe to knowledge == power.
I could tell you how, but I wont, because I don't think it's
a very good idea. Vicki doesn't want it, and there a certain
Mr. Becker on the net.loons list that is enough reason NOT to
do it.
Bob "but if Vicki changes her mind, it shall be done" O`Bob
From: obrien@netcom.com (No parking EXCEPT FOR BOB)
Subject: Re: alt.fan.vicki-robinson?
domiller@ualr.edu (Dale "Will mispell(sic) for food" Miller) writes:
>AFUl: Vicki Robinson will send you mail if you misspell her name.
Been there. Done that.
Now I can't use my favorite version, though:
"But I'm not quoted in Vicki Robinson's .sig!"
Bob "still not in Vicky Robinson's, though" O`Bob
From: wb8foz@skybridge.SCL.CWRU.Edu (David Lesher)
Subject: Re: The .sig girl makes the movies
I can't wait for the casting-couch stories, not to mention the
GIF's.....
From: wb8foz@skybridge.SCL.CWRU.Edu (David Lesher)
Subject: Re: Who is this Vicky chick???
Wasn't she the person rumored to be on the Grassy Knoll?
--
A host is a host from coast to coast..wb8foz@skybridge.scl.cwru.edu
& no one will talk to a host that's close............(301) 56-LINUX Unless the host (that isn't close).........................pob 1433 is busy, hung or dead..............vr virus-proof........20915-1433
Vicki Robinson |Derek's promised to POMS! Can life Odd physics professor |get any better? National Technical Institute for the Deaf |Alan Rosenthal is responsible for VJRNTS@ritvax.isc.rit.edu |96% of this .sig virus propagation.
--
Peter Fenelon - Research Associate - High Integrity Systems Engineering Group,
Dept. of Computer Science, University of York, York, Y01 5DD (+44/0)904 433388
Email: pete@minster.york.ac.uk ``Art is a science with more than 7 variables''
Q: Does Vicki Robinson have the Buddha-nature? A: Mu.
--
Paul Tomblin - Vicki Robinson's newsgroupie.
From: sderby@crick.ssctr.bcm.tmc.edu (Stuart P. Derby)
Subject: Re: Incredible Goof in Today's NYT Crossword
In article <2eg06c$4dp@usenet.INS.CWRU.Edu>
David Lesher <wb8foz@skybridge.scl.cwru.edu> writes:
> [Normandy invasion codeword/crossword puzzle story deleted]
>It's a good thing they did not let any details on other secret
>weapons such as the H2S, Panjandrum {sp?} and Vicki Robinson
>[Known as a Heath Robinson in UK] slip out.......
Heath Robinson? Is that what REALLY came in a Heath kit? And
have they stared making Vicki kits yet?
From: forbes@ihlpf.ih.att.com (Scott Forbes)
--
Who is Vicki Robinson, and why is she in my .sig?
Mike "and so does the Bates Motel" Edwards
--
Vicki Robinson .sig! Be the last one on your block to own one!
danny <kb2ddy> burstein
.. who tried calling out to vicki robinson on my portable, but got no answer..
--
From: ab401@freenet.carleton.ca (Paul Tomblin)
Subject: Vicki Robinson, where are you?
I sent out a newgroup for alt.fan.vicki.robinson about an hour before I saw
the thread discussing alt.fan.vicki-robinson. It didn't seem to work here,
but I've already recieved some flame mail about how I named it. If anybody
sees that group on your site, could you please let me know. And could
somebody newgroup it for real, since it appears that my newgroup isn't being
honoured here.
Paul "will create newsgroups when I figure out how" Tomblin
Cheers, Simon
Ceci n'est pas une Vicki Robinson .sig
Steve "Please tell me I'm missing something" Jones Don't have a sig.....sorry, Vicki.
Steve " An AFU Runs Through It" Jones
Still no sig, Vicki.
think anyway? | approached to endorse this product)
Alan "still looking for some equally definitive evidence against the Pope Joan
legend" Rosenthal
ObVicki: Perhaps Vicki Robinson is/was Pope Joan (and/or Sir Thomas Crapper).
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===GM/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===I won't put Vicki Robinson in my sig until she puts me in hers
Subject: Re: Conversation or correspondence... (was Re: AFU wiseguys, MOTTO!...)
From: joltes@husc7.harvard.edu (Richard Joltes)
Date: 13 Dec 1993 19:16:23 GMT
In article <1993Dec11.155126.1@woods.uml.edu> deyoungj@woods.uml.edu writes:
>John "Not in ANYONE'S .sig (yet)" DeYoung
Sorry, it's been done before. Won't work this time!
Regards Ray Depew rrd@fc.hp.com
Official AFU Executioner
@@@@@@@@@@ @@@@@@@@@@ @@@@@@@@@@ @@@@@@@@@@ @@@@@@@@@@
@@@@@@@@@@ @@@@@@@@@@ @@@@@@@@@@ @ and counting ...
(And a busy month it's been, what with weaning the newbies and all. Is
everybody comfy now? Everyone has their own space? Everyone at peace
with their inner selves? Everybody feels good about their Child
Within and the aura they project to others? Everybody has partaken
of the Zen of their keyboards? Everyone in sync with the rest of the
Internet? Good! Then let's cut this California-style crap, flush the
damn smileys down the toilet, leave Vicki (poor kid) alone, and get on
with the Urban Legends! Anybody know any good Rolls Royce stories?)
From: dbd@martha.utcc.utk.edu (David DeLaney)
Subject: Re: Vicki Robinson, where are you?
In article <ab401.755805452@freenet> ab401@freenet.carleton.ca writes:
>jrs@netcom.com (John Switzer) writes:
>>So, you're basically saying that not only do we have alt.fan.vicki.robinson,
>>but that someone is also going to create the properly named
>>alt.fan.vicki-robinson (soon to be followed, I'm sure by the variant
>>alt.fan.vicky-robinson).
>>And Algore wants to expand the net even more? Where will this madness end,
>>until everyone has their own newsgroup?
>Ah, you _have_ read the happynet manifesto, then.
>Paul "except that would be megabozo.john.switzer" Tomblin
So ... not only are her *.sig* references mutating at an incredible rate, her
*newsgroups* are too?
I'd be careful about letting this woman near my meals if I were you, people...
ObVicki: I will post (tomorrow) a quote for her FAQ which I found while
reading Stephen Jay Gould which seemed incredibly appropriate at the time...
ObAfuUL: Posting to this group for a time gives one special powers: witness
ted frank's trolling ability, vicki robinson's ubiquity and mutation powers,
derek tearne's regeneration abilities, Ray's incredibly accurate aim...
| UNIVERSITY OF ALABAMA | | P.O. BOX CO, TUSCALOOSA AL, 35487 | | (205) 348 - 5465 |
--
- Bill Seurer Language and Compiler Development IBM Rochester, MN Business: BillSeurer@vnet.ibm.com Home: BillSeurer@aol.com
Isn't there a Simon and Garfuncle song about Vicki?
Mike "will not eat snow for food" Edwards
...or beets. Rutabagas, however...
--
Vicki Robinson quote removed - Michael Hensley's wife kept asking
Jason Heimbaugh who this Vicki person was...
From: medwards@minos.Princeton.EDU (Kenny Bob (M.K.) Edwards)
Subject: V*ck* R*b*ns*n (was Holding your breath is DEADLY)
In article <2eir0q$c62@news.ysu.edu> ap974@yfn.ysu.edu (Rick Kitchen) writes:
Hey, don't feel bad, she e-mailed death threats to me, just because
I proposed alt.fan.vicki-robinson.
Perhaps she insists on sci.physics.odd instead? Hey tale!
Mike "or maybe rec.sport.vr.quote.quote.quote" Edwards
__
/ .\___ ___/. \
| ___| Run for your lives, Phil and PvdL are |___ |
__o | \ racing towards each other on enormous / | o__
_\<,__/ /\_> velociraptors and they _CAN'T_STOP_! <_/\ \__,>/_
/ / <\_-< >-_/> \ \
/ / \_-< (apologies to Derek Tearne) >-_/ \
--
- Kivi
jkshapir@descartes.uwaterloo.ca (Kivi Shapiro)
But I'm not in Vicki Robinson's .sig!
This message is in the public domain.
From: mhensley@netcom.com (Michael Hensley)
Subject: Re: support for FAQ assertions
Jason R. Heimbaugh posted:
: --
: Jason R. Heimbaugh - jrh@uiuc.edu
: Vicki Robinson quote removed - Michael Hensley's wife kept asking me who
: this Vicki person was...
Hey, both my wife and I are (albeit indirectly) quoted in someone's .sig!
Although my wife claims she doesn't know who Jason is...
Michael "I'm a regular, the question is: a regular WHAT?" Hensley
Note: Vicki is a BOT; I saw "her" on the T.V. sitcom "Small Wonder".
From: ab961@FreeNet.Carleton.CA (Robert Allison)
Subject: Re: alt.fan.vicki-robinson?
In a previous article, domiller@ualr.edu () says:
>AFUl: Vicki Robinson will send you mail if you misspell her name.
Regretably, that's an F. I said 'Vikki' in a post, and she ignored
my terrible (and accidental) error.
Robert "Vikki, Vickie, who cares? But what's Odd Physics?" Allison
From: vjrnts@ritvax.isc.rit.edu (Vicki Robinson)
Subject: Re: Myths
>leave Vicki (poor kid) alone,
You tell 'em Ray, y'..............? Hey. Hey! HEY! Let's just speak for
ourselves, here, Mr. Ray the Ex! Do I tell people to stop using emoticons
because Ray has fun chopping off heads? Do I? Huh? Well? Do I? Huh? HUH?
Furrfu!
The virus lives.
Vicki "What a smooth talker--almost had me *thinking*!" Robinson
Vicki Robinson |Derek's promised to POMS! Can life Odd physics professor |get any better? National Technical Institute for the Deaf |Dana Netz is responsible for VJRNTS@ritvax.isc.rit.edu |96% of this .sig virus propagation.
--
| David Adams | New economy sig. Sorry Vicki Robinson there is | | vera2@netcom.com | not enough room in here for your name. |
From: vjrnts@ritvax.isc.rit.edu (Vicki Robinson)
Subject: Re: Euphemisms (Was Re: Filthy computer games )
In article <1993Dec13.215014.13854@rchland.ibm.com>, seurer@rchland.vnet.ibm.com (Bill Seurer) writes:
>- Bill Seurer Language and Compiler Development IBM Rochester, MN
> Business: BillSeurer@vnet.ibm.com Home: BillSeurer@aol.com
> Isn't there a Simon and Garfuncle song about Vicki?
No, I keep telling you guys, that was my *Mom*!
Gee whiz, I'm mature, I'm not.............._motherly_!
Vicki "Sounds of Science, er, *Silence*" Robinson
__
Horacio A. Maiorino HMAIORINO@delphi.com
VR
Alan "then again, it tends to be an uphill battle" Rosenthal ObVicki: Since Vicki Robinson doesn't have a triangle nor a square in her .sig, we'll never know.
From: dbd@martha.utcc.utk.edu (David DeLaney)
Subject: Vicki Robinson FAQ quote
I submit (paraphrased from William Bateson, on Darwin):
"We shall honor most in her not the rounded merit of finite accomplishment, but
the creative power by which she inaugurated a line of discovery endless in
variety and extension."
Dave "not that I think her accomplishments aren't nicely rounded already"
DeLaney
think anyway? | Has Vicki Robinson dined with philosophers?
--
Nolan "Vicki, turn your back on me" Hinshaw
Internet: nolan@twg.com Dingalingnet: (415)962-7197
"What's loyalty got to do with cash?" Som Sikdar, 09 December 1993
From: derek@nezsdc.icl.co.nz (Derek Tearne)
Subject: Re: alt.fan.vicki-robinson?
In article <CI03AC.4MJ@freenet.carleton.ca> ab961@FreeNet.Carleton.CA (Robert Allison) writes:
>In a previous article, domiller@ualr.edu () says:
>>AFUl: Vicki Robinson will send you mail if you misspell her name.
>Regretably, that's an F. I said 'Vikki' in a post, and she ignored
>my terrible (and accidental) error.
You have to misspell it correctly. Vicky or Vickie will probably
work. Victoria Robertson almost certainly wouldn't although Triumpha
Robynsdatter apparently does.
Putting VicKibo in a post to AFU may generate interesting results
Remember find /usr/spool/news -exec egrep -i "vick|robins" {}\;
Won't find Vikki on any unix system I know of
Derek "The fact that VR uses VMS has no bearing on the above statement" Tearne
Thank you. I wonder if it's premature for me to add Vicki Robinson to my
.sigfile.
--
***** Orion Auld ***** *----------------------------------------------* "We are only fabulous | Vicki Robinson does not exist independently | beasts, after all." | From this .sigfile. | -- John Ashberry *----------------------------------------------*
From: wb8foz@skybridge.SCL.CWRU.Edu (David Lesher)
Subject: The End is Near...
Does anyone else recall the Arthur C. Clarke story:
The Nine Billion Names of God
Briefly, some monks in Tibet were using a computer to print out all the
possible variations of same, and when they reached it, The End would
arrive.
I'm seeing this Vicki_virus spreading out of control from .sig to .sig.
I'm getting worried. What happens when it is in _every_ sig? Is
that the secret message in "odd" physics???????
--
A host is a host from coast to coast..wb8foz@skybridge.scl.cwru.edu
& no one will talk to a host that's close............(301) 56-LINUX Unless the host (that isn't close).........................pob 1433 is busy, hung or dead..............vr virus-proof........20915-1433
Jacco `what's the size restrictions now that it's summer?' Z
From: kibo@world.std.com (James "Kibo" Parry)
Subject: Re: COMPUSERVE, KIBO SIGN EXCLUSIVE CONTRACT
In article <2ekqm4$p7p@harbinger.cc.monash.edu.au>,
Andrew Bulhak <acb@yoyo.cc.monash.edu.au> wrote:
> A spokesperson for CompuServe, Ms. Victoria
> Robinson, has foreshadowed that this could be the
You know, I'd think this were a joke if it weren't for the amazing
coincidence that this woman has almost the same first name as the robot
on my favorite TV drama, "Small Wonder". Makes you THINK, doesn't it?
> Ms. Robinson, however, refused to comment on
> the rumours that ClariNet, a commercial news
> service, have signed a syndication deal for Mr.
> Parry's material. "We're looking at a lot of options,"
> she said, "and at this stage we cannot disclose too
> much."
Actually, ClariNet considered it, but then Brad realized I wasn't funny.
Jim Finnis | "R'lyeh ph'tagn Vicki k'blort Robinson argh" white@elf.dircon.co.uk | ...!uunet!pipex!dircon!elf!white
--
Jason R. Heimbaugh - jrh@uiuc.edu
OK, the joke's old. Anyone who makes a reference to Vicki Robinson
in their .sig now is a dork.
From: vjrnts@ritvax.isc.rit.edu (Vicki Robinson)
Subject: Re: Euphemisms (Was Re: Filthy computer games )
In article <1993Dec14.232441.24002@twg.com>, nolan@twg.com (Articulate Mandible) writes:
>In article <1993Dec14.014743.22193@ultb.isc.rit.edu>,
> vjrnts@ritvax.isc.rit.edu (Vicki Robinson) writes:
>[bill seurer asks about a song title]
>|>No, I keep telling you guys, that was my *Mom*!
>But wasn't your maiden name Duggan? I think the Limelighters did a song ...
Nope, my 'maiden' name was Robinson, my 'married' name was Robinson, and my
'I'm FREE!!!' name is Robinson, but my first name used to be Elaine.
Vicki "You're too late!" Robinson
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===GM/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===I understand it is obligatory to mention Michael Hensley's wife in one's sig...........................
Vicki Robinson |Derek's promised to POMS! Can life Odd physics professor |get any better? National Technical Institute for the Deaf |Does anybody really care about my VJRNTS@ritvax.isc.rit.edu |orientation?
From: wsinkins@mbcr.bcm.tmc.edu (William G. Sinkins)
Subject: Re: The End is Near...
In article <2em5m7$3gv@usenet.INS.CWRU.Edu>, wb8foz@skybridge.SCL.CWRU.Edu (David Lesher) writes:
|> I'm seeing this Vicki_virus spreading out of control from .sig to .sig.
|> I'm getting worried. What happens when it is in _every_ sig? Is
|> that the secret message in "odd" physics???????
Relax. There is a small cabal of Usenetters, which includes me, that refuses
to use .sigs. Through our efforts, the Universe will be safe.
Bill '.sigless by choice' Sinkins
wsinkins@mbcr.bcm.tmc.edu
[Ha. Got you anyways. /jrh]
--
Paul Tomblin. In Vicki Robinson we trust.
"When viewed from the proper perspective, this thread is actually just a bunch
of people being silly." - Daniel Lottero
From: phil@rahul.net (Phil Gustafson)
Subject: UL's all used up? was: Re: Myths
}T. Vicki Robinson just might be a geek.
She's too far away to defend her honor appropriately, so I'll just slug
Chan in the face next time I see him.
Phil ":-)" Gustafson
--
__o __o __o __o __o __o __o __o __o Enneavelo: Quondam Whomper _-\<,--\<,--\<,--\<,--\<,--\<,--\<,--\<,--\<,_ Phil Gustafson (_)/----/----/----/----/----/----/----/----/ (_) phil@rahul.net
This Enormous Velocipede is stabilized by Odd Victorian Physics.
Joseph Scott | Maybe when I grow up I'll have Vicki University of Arizona | Robinson in my sig.
josephs@gas.uug.arizona.edu|
--
Andrea "No emoticons; Ray's too young to retire" Graham
(a_graham@oz.plymouth.edu) This is a token Vicki reference and that's all.
I'm not responsible for Plymouth State College;
but then again, who'd want to be?
Mike "will fake brain damage for food" Edwards
--
Vicki Robinson cannot consistently assert the voracity of this .sig.
Vicki Robinson |Derek's promised to POMS! Can life Odd physics professor |get any better? National Technical Institute for the Deaf |Find the guest .sig inhabitant. VJRNTS@ritvax.isc.rit.edu | --Vickivicki
--
Andrea "will not gut fish for food or mounting" Graham
(a_graham@oz.plymouth.edu) All-new economy .sig, free from Vicki--aw, darn.
From: billn@hpcvaac.cv.hp.com (bill nelson)
Subject: Re: The End is Near...
wb8foz@skybridge.SCL.CWRU.Edu (David Lesher) writes:
: Does anyone else recall the Arthur C. Clarke story:
: The Nine Billion Names of God
: Briefly, some monks in Tibet were using a computer to print out all the
: possible variations of same, and when they reached it, The End would
: arrive.
: I'm seeing this Vicki_virus spreading out of control from .sig to .sig.
: I'm getting worried. What happens when it is in _every_ sig? Is
: that the secret message in "odd" physics???????
Don't worry. There are quite a few who refuse to jump on every band wagon
that goes past. A very few even are tasteful enough to create their own
original signatures.
Bill
Jeffrey E. Chilton | CTTAGATTCAGAGCTAGGCTAATATATGCGCATATCATCGATC UW-Madison Dept. of Physics | CAAATGTACGCTAGCTCTGTCGAACCGTTATATCCGCGCC...
chilton@wishep.physics.wisc.edu | Vicki Robinson's DNA is in my .sig file.
From: ripton@e7sa.epi.syr.ge.com (Dave Ripton)
Subject: Re: The End is Near...
>|> I'm seeing this Vicki_virus spreading out of control from .sig to .sig.
>|> I'm getting worried. What happens when it is in _every_ sig? Is
>|> that the secret message in "odd" physics???????
>Relax. There is a small cabal of Usenetters, which includes me, that refuses
>to use .sigs. Through our efforts, the Universe will be safe.
>Bill '.sigless by choice' Sinkins
>wsinkins@mbcr.bcm.tmc.edu
Go, Bill. Actually, I did put Vicki in my .sig, out of respect for
The Bandwagon Factor. But I refuse to rename my .sig to .signature,
and thereby pollute all my posts with it.
Gee, one 'mv' virus and we're done for.
ObUL: U. All those .sigs are costing the net hundreds if not thousands of $.
Dave "No, Vicki Robinson, this doesn't count" Ripton
-Cindy Kandolf, cand.mage
cindy@lise.unit.no
Trondheim, Norway
I was told we have to mention Vicki Robinson in this newsgroup.
--
Still chasing Vicki Robinson on their enormous velocipede, the old hats have
become *extremely* confused. Phil Gustafson phil@rahul.net
__o __o __o __o __o __o __o __o __o _/-_|\
_-\<,--\<,--\<,--\<,--\<,--\<,--\<,--\<,--\<,_ | |
(_)/----/----/----/----/----/----/----/----/ (_) PERTH-->*_-__/
Bill "oh well, may as well. 'Vicki Robinson.' There." Duetschler ---
Joseph Scott | Vicki Robinson included in sig by University of Arizona | permission.
josephs@gas.uug.arizona.edu|
--
Rick Kitchen ap974@yfn.ysu.edu
Vicki Robinson has left the .sig
Alan "In fact, *Vicki*Robinson* is the one who is responsible for *100%* of this Vicki Robinson .signature thing." Rosenthal
[Michael's wife said something. /jrh]
Michael "But she *never* told Jason H. that." Hensley
--
Michael D. Hensley | It will be a cold day in heck before I follow-up mhensley@netcom.com | a Ted Frank troll^H^H^H^H^Hpost.
70700.763@compuserve.com | Vicki Robinson quote removed -- my wife kept Prodigy: Just say "NO". | asking who this Vicki person was.
Alan "but I do have an original recording of the Auntie Vicki show bloopers" R.
Phil "Never saw 'Studs' myself" Gustafson --
^ Goodness! Santa has lost his reindeer, but the enormous velocipede
x O __o __o __o __o __o __o __o __o __o. will get him to Vicki
/(_){-}+--_-\<,--\<,--\<,--\<,--\<,--\<,--\<,--\<,--\<,_ Robinson's house! \=====/ (_)/----/----/----/----/----/----/----/----/ (_) <phil@rahul.net>
Bill "living and working in Delawhere for food" Duetschler
--
/*********************************************************************
* * * "Really obnoxious huge warlord-esque .sig containing the name * * 'Vicki Robinson.' * * *
*********************************************************************/ ---
--
Joseph Askew, Gauche and Proud In the autumn stillness, see the Pleiades,
jaskew@spam.maths.adelaide.edu Remote in thorny deserts, feel the grief.
Disclaimer? Sue, see if I care North of our tents, the sky must end somwhere,
Vicki Robinson wants PostCards Beyond the pale, the River murmurs on.
From: netz@esa.lanl.gov (Dr. Memory)
Subject: Re: Euphemisms (Was Re: Filthy computer games )
In article <1993Dec15.040801.27455@ultb.isc.rit.edu>,
vjrnts@ritvax.isc.rit.edu (Elaine Robinson) wrote:
>==============================================================================
>Vicki Robinson |Derek's promised to POMS! Can life
>Odd physics professor |get any better?
>National Technical Institute for the Deaf |Dana Netz is responsible for
>VJRNTS@ritvax.isc.rit.edu |96% of this .sig virus propagation.
>===============================================================================.... gee, 96%???? I didn't think I was getting around THAT much.....
Dana "Holding up *MY* end" Netz
--
===Dana Netz, Electrical Systems Engineer | "All I know is, everything
===GM/DOE Electrochemical Engine Program | you know is wrong"
===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox
===I understand it is obligatory to mention Elaine Robinson in one's sig
Chandra (will refuse to impersonate Vicki Robinson, even for food)
--
Hmmm... now, which part of me does THIS cat own???
Chandra L. Morgan-Henley
ck290@Cleveland.Freenet.edu
Alan "makes a reference to Vicki Robinson but is not a dork" Rosenthal
Alan "if Prof Vicki Robinson doesn't arrive at AFU Toronto area II within 15 minutes of its scheduled time, all attendees are allowed to leave" Rosenthal
Alan "unlike the Vicki Robinson .signature virus" Rosenthal
Alan "still no snow in the Toronto area this year; well there was a little a few times but it didn't stick" Rosenthal Alan "when a wee lad, was jealous of my cousins in Connecticut who got several days off from school per year as 'snow days'; I think I got two in my entire childhood, and it snowed way more here then than it does now" Rosenthal Alan "Vicki Robinson probably gets more snow than I do" Rosenthal
Alan "ok then, it's the first time humans have ever intentionally extinguished a smallpox virus culture residing in lab XYZ in Atlanta Georgia" Rosenthal ObVicki: Vicki Robinson does not live in Atlanta Georgia.
Vicki Robinson |Michael Hensley's wife and I are Odd physics professor |going out to lunch, and I'm going National Technical Institute for the Deaf |to talk to her sternly about VJRNTS@ritvax.isc.rit.edu |invading my .sigs.
--
ted frank | I understand that it's obligatory to mention Majel Barrett
the u of c | in one's .signature because she was Michael D. Hensley's wife.
law school |
kibo#=0.5 | "Mmmm.... purple." -- Homer Simpson
Chandra "Vicki Robinson may be umop apisdn" Morgan-Henley
--
Hmmm... now, which part of me does THIS cat own???
Chandra L. Morgan-Henley
ck290@Cleveland.Freenet.edu
--
Michael D. Hensley | Vicki Robinson is never seen mhensley@netcom.com | drinking cappuccino in Italian restaurants
70700.763@compuserve.com | with Oriental women.
--
Mathias Koerber | Tel: +65 / 7780066 ext 29
SW International Systems Pte Ltd | Fax: +65 / 7779401
14 Science Park Drive #04-01 |
The Maxwell, Singapore Science Park | email: mathias@solomon.technet.sg
Singapore 0511 | swispl@solomon.technet.sg
Vince "who the hell is Vicky and why should I care when there are strange people doing strange things to strange animals while I write this extremely long and silly nickname" Cross
--
--
| David Adams | This is an Un-Registered Shareware version of the |
| vera2@netcom.com | Vicki Robinson sig. virus. Some features disabled |
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===GM/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===Knows both the Robinson sisters, Elaine and Vicki
From: cjl@maestro.maestro.com (Charles Lasner)
Subject: Re: support for FAQ assertions
In article <mhensleyCHzv00.LDJ@netcom.com> mhensley@netcom.com (Michael Hensley) writes:
>Note: Vicki is a BOT; I saw "her" on the T.V. sitcom "Small Wonder".
Vickie Sue Robinson never did record Turn the BOT Around.
cj "Adam West was in (Vickie) Robinson Crusoe on Mars" l
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===GM/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ==="But I'm in everybody's sig"- Vicki Robinson
Marci "Do I have to mention Vicki even if I'm a rare poster/constant lurker?" Tenpas
Steve "I'll get professional help when Vicki Robinson starts appearing
in my dreams" Jones
Steve Jones
Internet: steve.jones@hotbbs.raider.net
From: ab401@freenet.carleton.ca (Paul Tomblin)
Subject: Re: Call For Loons
steve.jones@hotbbs.raider.net (Steve Jones) writes:
>Steve "I'll get professional help when Vicki Robinson starts appearing
>in my dreams" Jones
I'll get professorial help in order to _make_ Vicki Robinson start appearing
in my dreams.
Paul "not that she doesn't already" Tomblin
From: wb8foz@netcom.com (David Lesher)
--
A host is a host from coast to coast.................wb8foz@nrk.com & no one will talk to a host that's close............(301) 56-LINUX Unless the host (that isn't close).........................pob 1433 is busy, hung or dead..............vr chevron-free.......20915-1433
--
Joseph Askew, Gauche and Proud In the autumn stillness, see the Pleiades,
jaskew@spam.maths.adelaide.edu Remote in thorny deserts, feel the grief.
Disclaimer? Sue, see if I care North of our tents, the sky must end somwhere,
Vicki Robinson Quote Free Zone Beyond the pale, the River murmurs on.
Chandra "will occasionally eat hot dogs for food" Morgan-Henley
Vicki Robinson does not appear in my .sig, but I'll mention
her anyway.
--
Hmmm... now, which part of me does THIS cat own???
Chandra L. Morgan-Henley
ck290@Cleveland.Freenet.edu
From: ck290@cleveland.Freenet.Edu (Chandra L. Morgan-Henley)
Subject: Re: Twas the Night Before Something
In a previous article, DENNYZEN@delphi.com () says:
>I beg your forebearance, gentle souls,
>for what follows, in that I know it full
>well to be: a) trite, b) metrically
>challenged, c) rhymatically deficient,
>d) neither parallel to nor as long as
>the original.
>
>Nonetheless I offer it in the spirit
>of the season.
[long, somewhat "cute" poem sacrificed to the gods of bandwidth]
The only problem with this piece is that nowhere, NOT ONCE,
did it mention Vicki Robinson!
Nice try, though.
Chandra "will not critique poems for food" Morgan-Henley
Ray "or vice-versa, I forget which" Sachs, who used to think VR stood for the Queen and Empress of India.
--
David Fiedler Internet:david@infopro.com or david@ost.com UUCP:infopro!david
USMail:InfoPro Systems, PO Box 220 Rescue CA 95672 Phone:916/677-5870 FAX:-5873
"Then, quick as you could say Vicki Robinson..."
If your reply to me bounces, your mail program doesn't understand Reply-To:
--
Dave "will invoke Vicki for food" DeLaney
--
Jason R. Heimbaugh - jrh@uiuc.edu
"Parking with Vicki beside the Information Superhighway."
Michael "I didn't even use a calculator to figure this one out, Vicki!" H.
--
/ Hagbard Celine / Yet another Illuminati Dupe / anrlw1@orion.alaska.edu /
/ micro-encapsulated Vicky Robinson .sig virus ~~> . <~~ "Vicky Inside" /
/ Fractalized Kibo #1.0317f / "All in all, I'd rather be morphing." - me /
I think anyway? | My wife doesn't know about Vicki Robinson yet
From: linden@positive.eng.sun.com (Peter van der Linden)
Subject: Gobbo the lucky imp
Keywords: stash the drugs here Vicki
--
Terry Monks tel@adiva.com Automata Design Inc (703) 742-9400
[ We are experiencing difficulty with the V*cki R%b&ns@n portion
of this sig. Please do not adjust your monitors.]
Ray "more veracity than a gerbil" Sachs But the real Cleveland was gone before Vicki Robinson was born.
--
Paul Tomblin.
Is it true that to mention "The Odd Professor" by name will bring bad luck?
-ottO S. "Who is thie Vicki Robinson person anyway?" Bagge Never take other peoples advice. (ottosb@oscar.bbb.no)
--
Paul Tomblin - snide Canadian.
I hope some day my ex-wife asks me who Vicki Robinson is.
--
- Kivi
jkshapir@descartes.uwaterloo.ca (Kivi Shapiro)
HI! Vicki Robinson is a .sig virus! Copy her into yours and join the fun!
This message is in the public domain.
From: dbd@martha.utcc.utk.edu (David DeLaney)
Subject: Re: Trolls, Trolls, Trolls
cindy@lise.unit.no (Cynthia Kandolf) writes:
>That's bokm}l. In nynorsk that would be:
>"ikkje vicki robinson"
Does this mean we've got a nickname for her: "Icky Vicki"?
Dave "no, Vicki - put that .sig back - aaaiiiieeee!" DeLaney
From: Sven Guckes <guckes@inf.fu-berlin.de>
Subject: Vicki Robinson died of sig virus
Ha - don't say I didn't get your attention!
Greetings to the AFW Inner Circle, Kibo, and other Net Lurkers!
Sven :)
--
I kept asking myself who this Vicki Robinson is until my wife told me
that I have to have her in my sig to be enlightened. (Women!)
Ray "admirer of Nell Gwynne's ..uh.. patriotism" Sachs Writing in 1994, at the height of merry Vicki Robinson's golden days.
From: "Len Berlind" <p00881@psilink.com>
Subject: Re: A question.....
>DATE: Fri, 31 Dec 93 09:10:33 GMT
>FROM: Chip Dunham <hd0022@albnyvms.bitnet>
> WHO THE HELL IS VICKI ROBINSON?
If you have to ask, you can't afford one.
--Len
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===No reference to V*ck* R*b*ns*n in _this_ .sig
These are my opinions only!! Vicki Robinson: have you had
your Ovaltine today?
--
Linda Richards My ex-husband might ask who
Linda_Richards@mindlink.bc.ca this Vicki Robinson person
is. But he'd just want her
Nicely healed, thank you. phone number.
From: bml@netcom.com (Brian Leibowitz)
Subject: Re: A question.....
In article <2ga5g6$p1v@news.ysu.edu> ap974@yfn.ysu.edu (Rick Kitchen) writes:
>In a cosmic sense, are we not all Vicki?
I am not Vicki! I am a free man!
Ha Ha Ha Ha ha.............................
Brian "I once had a student with an American sign interpreter in a seminar
I was teaching - maybe in a little way I am somewhat Vicki" Leibowitz
Cheers,
-- jr "Vicki Robinson is _not_ a koala bear. Cuuddly as one, though" a
--
Jay Ashworth -via fidonet gateway 1:3603/330
Internet: Jay.Ashworth@f160.n3603.z1.FIDONET.ORG
Note: The opinions stated in this post are only my own!
Curt "saw Vicki Robinson in Penthouse once" Shehow
Todd "Will drive drunk for food?" Larason
--
"They're Vickified, and they're Ancient, and they like to be in Sigs"
--
Peter Sullivan [Internet: peter@manorcon.demon.co.uk]
"Is it considered the height of a.f.u. naffness to ask who Vicki Robinson
is in your .sig?"
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong"
===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===Vicki Robinson is not 100% pure bull..........
--
David Thomas (david@micro.ti.com)
Texas Instruments, Houston (713)-274-2347
"No calculators!" -- Vicki Robinson
Chris Fishel * "In the winter, I'm a Buddhist*
University of Virginia * & in the summer I'm a nudist"*
ctf2m@virginia.edu * -Joe Gould (U. S. poet and *
* translator of the *
* language of the seagulls) *
*********************************
Note: On Shrove Tuesday, I am Vicki Robinson.
From: vjrnts@ritvax.isc.rit.edu (Vicki Robinson)
Subject: Re: A question.....
In article <CJ4w87.Bvn@murdoch.acc.Virginia.EDU>, ctf2m@kelvin.seas.Virginia.EDU (CHE STUD) writes:
>tom@drutx.att.com writes:
>> In article <CJ2CxI.G52@fc.hp.com> rrd@fc.hp.com (Ray Depew) writes:
>> >Chip Dunham (hd0022@albnyvms.bitnet) asks innocently:
>> >: Just a question for those of you who have been here a while. Now, I've been
>> >: here a few weeks and have only one, so that's not too bad:
>> >: WHO THE HELL IS VICKI ROBINSON?
>> >: Thanks.
>> >I AM VICKI ROBINSON.
>> >Regards
>> >Ray "next!" Depew
>> I'M VICKI ROBINSON
>> Tom "I love you, Thparticuth" Madden
> Our celbrity judges have made their decisions. And now will the
>real Vicki Robinson please stand up...
OK, so where were all of you when Vicki's driveway needed to be unearthed from
much snow this afternoon, that's what I want to know.
The real Vicki Robinson will stand up when her back will allow her to.
Vicki "Oh, sure, *everybody* wants a piece of the action, but when push comes
to shove....." Robinson
Vicki Robinson |I am often seen drinking Odd physics professor |cappuccino in restaurants with National Technical Institute for the Deaf |deaf women,however. And bald VJRNTS@ritvax.isc.rit.edu |guys, too.
S > DarkMage "wtf is Vicki Robinson?" the Clueless
If you are clueless, please see Jonathan "punk" Papai, who will be
glad to e-mail you one clue.
As for Vicki Robinson, please ask Paul Tomblin, who I believe is
President of her Fan Club, and AFU's Official Vicki Robinson Groupie.
Or, ask Michael Hensly, her husband.
Bill "In Vicki Veritas" Duetschler
From: otto_bagge@yro.fidonet.bbs.no (Otto Bagge)
Subject: Re: Trolls, Trolls, Trolls
>>"ikkje vicki robinson"
> Does this mean we've got a nickname for her: "Icky Vicki"?
"Ikkje Vicki Robinson" means "Not Vicki Robinson". ('Ikkje' is
nynorsk, the bokmaal equivalent is 'ikke').
-Otto "Vicki Robinson er kuul! :-)" Baggins
(ottosb@oscar.bbb.no)
| Brendan Hassett Tel +353-902-74601 ext 1109 ECN 830-1109 | | eeibht@eeiud.ericsson.se EEI.EEIBHT@memo.ericsson.se ~~~ |
| Ericsson Systems Expertise Ltd, Athlone, Ireland, EU. ( o o ) | ---------------------------------------------------------ooO-(_)-Ooo #include <vicki.h>
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===Who would have thought that Vicki Robinson's 15 minutes would last this long
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===Vicki Robinson was seen sipping Capriccio with gerbils
Brian "I can't take it any more - I've folded under peer pressure -
I have to put Vicki in my sig." Leibowitz
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===Next semester Vicki Robinson will teach Even Physics
Dana "but only if Vicki will let me" Netz
--
===Dana Netz, Electrical Systems Engineer | "All I know is, everything
===AEC/DOE Electrochemical Engine Program | you know is wrong"
===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox
==="But I'm not in anyone's .sig" -Majel Barrett
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong"
===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===Swirling down the drain of life with Vicki Robinson by my side......
Dana "no cross-posting to alt.ittie.bittie.titties" Netz
--
===Dana Netz, Electrical Systems Engineer | "All I know is, everything
===AEC/DOE Electrochemical Engine Program | you know is wrong"
===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox
===Has never seen Vicki posting to a.i.b.t
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===ObUL: The Farsi translation of "Enlightened One" is "Vicki Robinson"
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ==="Danger, Vicki Robinson, danger!"- robot on Space 1999
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===Has Vicki Robinson on SpeedDial
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===Vicki Robinson is either a tall redhead or she's not
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===There's a boy named Ricki Vobinson who's dying of .sig virus .....
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===sVuIbClKiImRiOnBaIlN.SsOiNg
"And I thought that VR stood for Virtual Reality..."
+-------------------------+
| brettg@zed.com |
| brett.glaysher@rose.com |
--
Joe George (jgeorge@crl.com, jgeorge@nbi.com)
The NBI Press: Typesetting, Graphic Artwork, Fine Italian Cuisine
President of the Atlanta chapter of the Vicki Robinson Fan Club
"Usenet is a cesspool, a dungheap." -Patrick Townson
schweppe@bumetb.bu.edu (Edmund Schweppe) writes:
>aa724@FreeNet.Carleton.CA (Jessica Cohen) writes:
>>In a previous article, kibo@world.std.com (James "Kibo" Parry) posts his
>>really long sig, and forgets to add the Vicki Robinson sig virus.
>No he didn't! He added the Vicki Robinson Mk. II "stealth" sig virus! The
>one without any visible characters at all!
>>--
>And it worked, too ... at least on Jessica's machine ...
From: jfurr@char.vnet.net (Joel Furr)
Subject: Vicki Robinson: The Madness Ends
Date: 6 Jan 1994 00:36:39 -0500
In my capacity as thread-terminator of alt.folklore.urban, I hereby
declare "Please take this interminable Vicki Robinson .sig fad to a more
appropriate newsgroup, such as alt.fan.warlord or talk.bizarre or
alt.really-boring."
It's gotten old. It's gotten STAGGERINGLY old. It's gotten so old that
people have lost sight of how old it's gotten and have started KEEPING
TRACK of who's COOL ENOUGH to have included Vicki Robinson in their
.sig. Ye gods -- to think that a reader of alt.folklore.urban would
actually sit there, noting down who's used the words "vicki robinson" in
their .sig. Yet it's happened.
Just let it drop. It's no longer funny, not that it was ever very funny
in the first place, and it's getting to be a serious pathology in a.f.u.
when people sling barbs back and forth about who does a better job using
"Vicki Robinson" in their .sig. Just let it drop. Let the madness end.
Joel "Has NEVER used 'Vicki Robinson' in his .sig" Furr
From: jfurr@char.vnet.net (Joel Furr)
Subject: Re: Vicki Robinson died of sig virus
Date: 6 Jan 1994 00:57:39 -0500
In article <QHOKB0JC@math.fu-berlin.de>,
Sven Guckes <guckes@inf.fu-berlin.de> wrote:
>Ha - don't say I didn't get your attention!
>Greetings to the AFW Inner Circle, Kibo, and other Net Lurkers!
>Sven :)
>--
>I kept asking myself who this Vicki Robinson is until my wife told me
>that I have to have her in my sig to be enlightened. (Women!)
Congratulations. You are officially declared Official Loser of
alt.folklore.urban for the first week of 1994.
Please take this interminable Vicki Robinson fad to alt.really-boring.
Joel "testy" Furr
Christopher "will not mention Vicki Robinson without meeting her first..oops, to late....." Ronnfeldt
--
Paul Tomblin - snide Canadian.
Vicki Robinson reference removed on request of Joel Furr.
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ===One of these days, Vicki Robinson will ask about Paul Tomblin's ex-wife
Dave Mooney dmm@vnet.ibm.com
"Vicki, have you ever *seen* a yak?" -- CBC Interviewer
Peter "or maybe it's just the squitty little 50p tourist maps don't
have 'Ronald MacDonald Lived Here'." Sullivan
--
peter@manorcon.demon.co.uk
Still just a little bit too much of a newbie to be allowed
to mention Vicki in his sig, but fully aware of the dangers of
including a :-)
--
Michael D. Hensley | Vicki Robinson is never seen mhensley@netcom.com | drinking cappuccino in Italian restaurants
70700.763@compuserve.com | with Oriental women.
--
Paul Tomblin - snide Canadian.
Joel Furr can have my Vicki Robinson sig when he prys it from my cold, dead
fingers.
From: dmm@vnet.ibm.com (Dave Mooney)
Subject: Re: Trolls, Trolls, Trolls
In <ab401.757890462@freenet>, ab401@freenet.carleton.ca (Paul Tomblin) writes:
> Paul Tomblin - snide Canadian.
> Joel Furr can have my Vicki Robinson sig when he prys it from my cold, dead
> fingers.
When Vicki Robinson .sigs are outlawed, only outlaws will have Vicki Robinson
in their .sigs.
Dave "Vicki Robinson .sigs don't kill people, lack of oxygen to the brain
kills people" Mooney
Bill "obnoxious Delawarean of AFU" Duetschler
--
/*********************************************************************
* a.f.u's | bill.duetschler@royal.com | "Irgendwo in der Tiefe | * official | "In Vicki veritas." | Gibt es ein Licht." | * Delawarean. | | --Kate Bush |
*********************************************************************/
From: phil@rahul.net (Phil Gustafson)
Subject: Re: 1 Million?? (Try again - with some control)
Kivi Shapiro <jkshapir@undergrad.math.uwaterloo.ca> wrote:
>In article <lrudolph.757713938@black.clarku.edu>,
>>Do we really understand what a million of anything is?
>Someone just came out with a book containing a
>million dots and nifty tidbits of info about some of the more
>interesting integers.
That would be _One Million_, by Hendrick Hertzberg, Times Books,
1993, paperback, $14, Kivi. 4to, at least, I guess.
I haven't bumped into this book myself, but it was reviewed in the
December, 1993, SciAm. The book has two hundred pages with 5,000
black dots apiece. About a thousand dots get special attention: the
population of Eden, the number of steps to the top of the Empire State
Building, the weight of a swarm of locusts, the number of interracial
married couples is the U.S., and about a thousand more.
The first edition was first published 20 years ago when it cost only
145 cents more than two fifty.
I briefly considered getting a copy for my six-year-old nephew, but
wisely decided he'd prefer something noisy.
Phil "The number of Vicki Robinson .sigs is still only on page one: Do
Your Part" Gustafson
From: warren@vaccine.worlds.com (Warren Burstein)
Subject: VR citing
In <telecom14.12.7@eecs.nwu.edu> jgeorge@nbi.com (Joe George) signs:
Joe George (jgeorge@crl.com, jgeorge@nbi.com) The NBI Press: Typesetting, Graphic Artwork, Fine Italian Cuisine If I put Vicki Robinson in my sig, will she put me in hers? "Usenet is a cesspool, a dungheap." -Patrick Townson And Pat "comp.dcom.telecom died for our sins" Townson adds
[TELECOM Digest Editor's Note: I dunno about Vicki Robinson but if you put me in your .sig I'll be sure not to truncate it when I publish your fine cuisine (of some sort!) in this Digest. <grin> ... PAT]
--
David DeLaney: dbd@utkux.utcc.utk.edu; ObQuote: `I suggest quoting 'J"K"P' and
'J"RR"P' both. --K' Disclaimer: AFAIK, *nobody* speaks for U.T.Knoxville __
(consistently); Thinking about this disclaimer (or about theor. particle \/
physics) may cause headaches. Vicki and Kibo have not yet met. Kibo #: +1
Helge "Just don't ask me about network routers!" Moulding
(Just another guy with Vicki Robinson in his .sig)
Now *how* did that get in there? Better check my .sig again!
--
/*********************************************************************
* a.f.u's | bill.duetschler@royal.com | "Irgendwo in der Tiefe | * official | Vicki Robinson reference | Gibt es ein Licht." | * Delawarean. | included to annoy Joel Furr| --Kate Bush |
*********************************************************************/
From: wb8foz@netcom.com (David Lesher)
"If Vicki talks about us in the dark, will anybody know"?
--
-Otto "Why don't I have a girlfriend who could ask me who this Vicki
Robinson person is, so I could write in my .sig that I had to stop
mentioning Vicki in my .sig because my girlfriend kept asking me who
this Vicki person is...." Bagge
(Ottosb@oscar.bbb.no)
From: Jay.Ashworth@f160.n3603.z1.FIDONET.ORG (Jay Ashworth)
Subject: Re: From the FAQ...
CS> Curt "saw Vicki Robinson in Penthouse once" Shehow
GGGGGGGGGG IIIIIIIII FFFFFFFFFFFFFFFFFF !!!
GGGGGGGGGGGGG IIIIIIIII FFFFFFFFFFFFFFFFFF !!!
GGGGGGGGGGGGGGG IIIIIIIII FFFFFFFFFFFFFFFFFF !!!
GGGGG GGGGG IIIIIIIII FFFFFFFF !!!
GGGGGG IIIIIIIII FFFFFFFF !!!
GGGGGG IIIIIIIII FFFFFFFFFFFFFFFFFF !!!
GGGGGG GGGGGGG IIIIIIIII FFFFFFFFFFFFFFFFFF !!!
GGGGGG GGGGGGG IIIIIIIII FFFFFFFFFFFFFFFFFF !!!
GGGGGG GGGG IIIIIIIII FFFFFFFF !!!
GGGGGG GGGG IIIIIIIII FFFFFFFF !!!
GGGGG GGGG IIIIIIIII FFFFFFFF
GGGGGGGGGGGGGGG IIIIIIIII FFFFFFFF !!!
GGGGGGGGGGGG IIIIIIIII FFFFFFFF !!!
Cheers,
-- jr "Will hand-build obnoxious banners for Vicki Robinson" a
Alan "but I'm not in Vicki Robinson's .sig" Rosenthal
--
Linda Richards I understand it is
Linda_Richards@mindlink.bc.ca obligatory to mention
Joel Furr in you
Nicely healed, thank you. signature.
--
Christian Longshore Claiborn, Software Engineer, Cabletron Systems
My opinions are those of Vicki Robinson.
Steve Caskey | Disclaimer: If anyone cared what I thought (caskey_s@kosmos.wcc.govt.nz) | I'd be rich and famous. QED. "Ace barbed-wire hurdler until |------------------------------------------- his tragic accident." | I can't understand how my mother-in-law
Vicki Robinson |Steve Caskey's mum-in-law Odd physics professor |is a very nice person, we National Technical Institute for the Deaf |had such a *pleasant* VJRNTS@ritvax.isc.rit.edu |lunch the other day!
Dan (Will I be forgiven if I mention Vicki Robinson?) Prener --
Dan Prener (prener@watson.ibm.com)
Drew "though I am interested in the
tall redhead version of Vicki" Lawson
--
Drew Lawson | Whereupon he saw himself in Balance
dlawson@netcom.com | and he knew that he was
Jack "If you DOUBT his VORACITY" Mayo
--
mayojoh@ac.com | Disclaimer: What I say isn't what they say.
Who is this Vicki Kibo person, anyway?
From: acb@yoyo.cc.monash.edu.au (Andrew Bulhak)
Subject: Re: Trolls, Trolls, Trolls
Eddie Saxe (saxe@cs.unc.edu) wrote:
: --
: Pixel-planes research group Developing linearly scalable VR technology
--
.sig virus research group Developing linearly scalable VR references
--
Jason R. Heimbaugh - jrh@uiuc.edu
By request from Joel Furr, this .sig only mentions Vicky Hostetler
and compliments her husband, Jeff, on his *3* victories over the
hated Broncos this season: Speed Kills!
===Dana Netz, Electrical Systems Engineer | "All I know is, everything ===AEC/DOE Electrochemical Engine Program | you know is wrong" ===Los Alamos Nat'l Labs, New Mexico | - "Happy" Harry Cox ==="But Vicki Robinson is in everyone's .sig," Joel Furr
--
Peter Sullivan [Internet: peter@manorcon.demon.co.uk] thinks that
Vicki Robinson .sigs are silly, but fun. A bit like a.f.u, in fact.
Vince "Will not spell out Vicky Robinson's name in flaming fecal matter" Cross --
From: jfurr@char.vnet.net (Joel Furr)
Subject: sig viruses
Date: 10 Jan 1994 17:44:38 -0500
In article <36229@mindlink.bc.ca>,
Linda Richards <Linda_Richards@mindlink.bc.ca> wrote:
>Linda Richards I understand it is
>Linda_Richards@mindlink.bc.ca obligatory to mention
> Joel Furr in your
>Nicely healed, thank you. signature.
Don't. Just don't.
Joel "It would make Tim Pierce jealous" Furr
-jJ "Is Vicki Robinson's driveway yet clear?" _____
|\ /|
Take only memories. jimj@eecs.umich.edu | 0 |
Leave not even footprints. jewett+@pitt.edu |/_\|
(ask VJRNTS@ritvax.isc.rit.edu about the quote.)
Heather "I'm not Vicki Robinson, but I wish I were" Kendrick
Heather M. Kendrick "Joblessness is no longer just for philosophy kendrhe@earlham.edu majors. Now useful people are feeling the pinch." (Philosophy major with a sense of humor) --"The Simpsons"
Peter 'Clive James is better than _Star Trek_' Thompson
:r .sig
If I put Victoria Williams into my .sig, will it keep Vicki Robinson out?
Vince "will shoot Joel Furr if he threatens my sig" Cross ObVR: <obligatory "Vicky" reference> - Joel is the Anti-Vicky
rgds-- TA (tallard@frb.gov)
The opinions expressed in this article are that of the Board of
Governors of the Federal Reserve System and do not represent
the views of the poster. Oh wait, I got that backwards!
pgp key available on servers...
...see alt.security.pgp if you don't know what that means.
ObVickiRobinson
From: jkshapir@undergrad.math.uwaterloo.ca (Kivi Shapiro)
Su